EMAIL THIS PAGE TO A FRIEND

SRSF9

serine/arginine-rich splicing factor 9

Synonyms: SFRS9 SRp30c
UniProtKB ID: Q13242, Q52LD1
Gene ID:
Human(8683) Summary: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two pseudogenes, one on chromosome 15 and the other on chromosome 21, have been found for this gene. [provided by RefSeq, Sep 2010]
Mouse(108014) serine/arginine-rich splicing factor 9
Rat(288701) serine/arginine-rich splicing factor 9
Zebrafish(405835) serine/arginine-rich splicing factor 9
dog(477510) serine/arginine-rich splicing factor 9
Horse(100053376) serine/arginine-rich splicing factor 9
domestic cat(101081418) serine/arginine-rich splicing factor 9
domestic guinea pig(100720828) serine/arginine-rich splicing factor 9
naked mole-rat(101697219) serine/arginine-rich splicing factor 9
cow(509905) serine/arginine-rich splicing factor 9
sheep(101118221) serine/arginine-rich splicing factor 9
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV40490 Anti-SFRS9 antibody produced in rabbit affinity isolated antibody bovine, horse, rabbit, Caenorhabditis elegans, zebrafish, guinea pig, human, mouse, rat, canine, pig
western blot pricing
SAB2700770 Anti-SRSF9 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1401432 Monoclonal Anti-SFRS9 antibody produced in mouse clone 1G7, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003769 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003769 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003769 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025573 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025573 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025573 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU081391 MISSION® esiRNA esiRNA targeting mouse Sfrs9 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003769 Rosetta Predictions human pricing
NM_001009255 Rosetta Predictions rat pricing
NM_025573 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003769 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220732 predicted 449
2 SASI_Hs01_00220733 predicted 439
3 SASI_Hs01_00220735 predicted 455
4 SASI_Hs02_00336260 predicted 467
5 SASI_Hs01_00220736 predicted 586
6 SASI_Hs02_00336261 predicted 471
7 SASI_Hs01_00220737 predicted 450
8 SASI_Hs01_00220738 predicted 547
9 SASI_Hs01_00220739 predicted 438
10 SASI_Hs01_00220741 predicted 436
11 SASI_Hs01_00220734 predicted 516
12 SASI_Hs01_00220740 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009255 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112477 predicted 568
2 SASI_Rn01_00112478 predicted 374
3 SASI_Rn01_00112479 predicted 531
4 SASI_Rn01_00112480 predicted 297
5 SASI_Rn01_00112481 predicted 372
6 SASI_Rn01_00112482 predicted 584
7 SASI_Rn01_00112483 predicted 364
8 SASI_Rn01_00112484 predicted 570
9 SASI_Rn01_00112485 predicted 378
10 SASI_Rn01_00112486 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025573 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118292 predicted 447
2 SASI_Mm01_00118293 predicted 641
3 SASI_Mm01_00118294 predicted 608
4 SASI_Mm01_00118295 predicted 604
5 SASI_Mm01_00118296 predicted 463
6 SASI_Mm01_00118298 predicted 660
7 SASI_Mm01_00118299 predicted 613
8 SASI_Mm01_00118300 predicted 351
9 SASI_Mm01_00118301 predicted 443
10 SASI_Mm02_00328550 predicted 512
11 SASI_Mm01_00118297 predicted 351
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003769
VALIDATED
SRSF9 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003769.2-642s21c1
Sequence:CCGGGATGACACCAAATTCCGCTCTCTCGAGAGAGCGGAATTTGGTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003769.2-954s21c1
Sequence:CCGGATTTCTACCAGGGCCATATTACTCGAGTAATATGGCCCTGGTAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003769.2-458s21c1
Sequence:CCGGTCCTACAAGAAGATCTGATTTCTCGAGAAATCAGATCTTCTTGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_003769.2-629s21c1
Sequence:CCGGCCTGCGTAAACTGGATGACACCTCGAGGTGTCATCCAGTTTACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003769.2-356s21c1
Sequence:CCGGTGGAAGAAATGGTTATGATTACTCGAGTAATCATAACCATTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006630    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_003769.2-551s1c1
Sequence:CCGGGACACCAAATTCCGCTCTCATCTCGAGATGAGAGCGGAATTTGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006631    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_003769.2-548s1c1
Sequence:CCGGGATGACACCAAATTCCGCTCTCTCGAGAGAGCGGAATTTGGTGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006633    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_003769.2-536s1c1
Sequence:CCGGCTGCGTAAACTGGATGACACCCTCGAGGGTGTCATCCAGTTTACGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003769.2-459s1c1
Sequence:CCGGATGTCTGTTATGCTGATGTGCCTCGAGGCACATCAGCATAACAGACATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006632    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_003769.2-535s1c1
Sequence:CCGGCCTGCGTAAACTGGATGACACCTCGAGGTGTCATCCAGTTTACGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003769
VALIDATED
SRSF9 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003769.2-642s21c1
Sequence:CCGGGATGACACCAAATTCCGCTCTCTCGAGAGAGCGGAATTTGGTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003769.2-954s21c1
Sequence:CCGGATTTCTACCAGGGCCATATTACTCGAGTAATATGGCCCTGGTAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003769.2-458s21c1
Sequence:CCGGTCCTACAAGAAGATCTGATTTCTCGAGAAATCAGATCTTCTTGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_003769.2-629s21c1
Sequence:CCGGCCTGCGTAAACTGGATGACACCTCGAGGTGTCATCCAGTTTACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003769.2-356s21c1
Sequence:CCGGTGGAAGAAATGGTTATGATTACTCGAGTAATCATAACCATTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006630    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_003769.2-551s1c1
Sequence:CCGGGACACCAAATTCCGCTCTCATCTCGAGATGAGAGCGGAATTTGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006631    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_003769.2-548s1c1
Sequence:CCGGGATGACACCAAATTCCGCTCTCTCGAGAGAGCGGAATTTGGTGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006633    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_003769.2-536s1c1
Sequence:CCGGCTGCGTAAACTGGATGACACCCTCGAGGGTGTCATCCAGTTTACGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003769.2-459s1c1
Sequence:CCGGATGTCTGTTATGCTGATGTGCCTCGAGGCACATCAGCATAACAGACATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006632    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_003769.2-535s1c1
Sequence:CCGGCCTGCGTAAACTGGATGACACCTCGAGGTGTCATCCAGTTTACGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003769
VALIDATED
SRSF9 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003769.2-642s21c1
Sequence:CCGGGATGACACCAAATTCCGCTCTCTCGAGAGAGCGGAATTTGGTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003769.2-954s21c1
Sequence:CCGGATTTCTACCAGGGCCATATTACTCGAGTAATATGGCCCTGGTAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003769.2-458s21c1
Sequence:CCGGTCCTACAAGAAGATCTGATTTCTCGAGAAATCAGATCTTCTTGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_003769.2-629s21c1
Sequence:CCGGCCTGCGTAAACTGGATGACACCTCGAGGTGTCATCCAGTTTACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003769.2-356s21c1
Sequence:CCGGTGGAAGAAATGGTTATGATTACTCGAGTAATCATAACCATTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006630    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_003769.2-551s1c1
Sequence:CCGGGACACCAAATTCCGCTCTCATCTCGAGATGAGAGCGGAATTTGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006631    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_003769.2-548s1c1
Sequence:CCGGGATGACACCAAATTCCGCTCTCTCGAGAGAGCGGAATTTGGTGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006633    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_003769.2-536s1c1
Sequence:CCGGCTGCGTAAACTGGATGACACCCTCGAGGGTGTCATCCAGTTTACGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003769.2-459s1c1
Sequence:CCGGATGTCTGTTATGCTGATGTGCCTCGAGGCACATCAGCATAACAGACATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006632    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_003769.2-535s1c1
Sequence:CCGGCCTGCGTAAACTGGATGACACCTCGAGGTGTCATCCAGTTTACGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025573
SRSF9 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 9
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000071519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025573.2-225s1c1
Sequence:CCGGCGAGGACTTGTTCTACAAGTACTCGAGTACTTGTAGAACAAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025573.2-345s1c1
Sequence:CCGGTGGAAGAAACGGTTACGATTACTCGAGTAATCGTAACCGTTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025573.2-622s1c1
Sequence:CCGGCGTAAACTGGATGACACCAAACTCGAGTTTGGTGTCATCCAGTTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025573.2-507s1c1
Sequence:CCGGGCAGGACCTGAAAGATCACATCTCGAGATGTGATCTTTCAGGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025573
SRSF9 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 9
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000071519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025573.2-225s1c1
Sequence:CCGGCGAGGACTTGTTCTACAAGTACTCGAGTACTTGTAGAACAAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025573.2-345s1c1
Sequence:CCGGTGGAAGAAACGGTTACGATTACTCGAGTAATCGTAACCGTTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025573.2-622s1c1
Sequence:CCGGCGTAAACTGGATGACACCAAACTCGAGTTTGGTGTCATCCAGTTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025573.2-507s1c1
Sequence:CCGGGCAGGACCTGAAAGATCACATCTCGAGATGTGATCTTTCAGGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025573
SRSF9 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 9
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000071519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025573.2-225s1c1
Sequence:CCGGCGAGGACTTGTTCTACAAGTACTCGAGTACTTGTAGAACAAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025573.2-345s1c1
Sequence:CCGGTGGAAGAAACGGTTACGATTACTCGAGTAATCGTAACCGTTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025573.2-622s1c1
Sequence:CCGGCGTAAACTGGATGACACCAAACTCGAGTTTGGTGTCATCCAGTTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025573.2-507s1c1
Sequence:CCGGGCAGGACCTGAAAGATCACATCTCGAGATGTGATCTTTCAGGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks