EMAIL THIS PAGE TO A FRIEND

SRXN1

sulfiredoxin 1

Synonyms: C20orf139 Npn3 SRX SRX1
UniProtKB ID: Q9BYN0, B2R543, Q8NDM3, Q96AK6
Gene ID:
Mouse(76650) sulfiredoxin 1 homolog (S. cerevisiae)
Rat(296271) sulfiredoxin 1
Zebrafish(100331561) sulfiredoxin 1 homolog (S. cerevisiae)
domestic cat(101090507) sulfiredoxin 1
chicken(100858692) sulfiredoxin 1
cow(531606) sulfiredoxin 1
sheep(101121699) sulfiredoxin 1
naked mole-rat(101726463) sulfiredoxin 1
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501200 Anti-SRXN1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029688 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029688 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029688 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080725 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080725 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080725 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080725 Rosetta Predictions human pricing
NM_001047858 Rosetta Predictions rat pricing
NM_029688 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061731 predicted 367
2 SASI_Hs01_00061732 predicted 359
3 SASI_Hs01_00061733 predicted 422
4 SASI_Hs01_00061734 predicted 494
5 SASI_Hs02_00362504 predicted 488
6 SASI_Hs02_00362505 predicted 416
7 SASI_Hs01_00061735 predicted 2168
8 SASI_Hs01_00061738 predicted 1935
9 SASI_Hs02_00362506 predicted 1865
10 SASI_Hs02_00362507 predicted 2075
11 SASI_Hs01_00061736 predicted 1948
12 SASI_Hs01_00061737 predicted 1998
13 SASI_Hs01_00061739 predicted 1141
14 SASI_Hs01_00061740 predicted 1315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047858 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206255 predicted 799
2 SASI_Rn02_00206256 predicted 960
3 SASI_Rn02_00206257 predicted 233
4 SASI_Rn02_00206258 predicted 561
5 SASI_Rn02_00206259 predicted 555
6 SASI_Rn02_00206260 predicted 842
7 SASI_Rn02_00206261 predicted 848
8 SASI_Rn02_00206262 predicted 665
9 SASI_Rn02_00206263 predicted 957
10 SASI_Rn02_00206264 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335727 predicted 826
2 SASI_Mm02_00335728 predicted 511
3 SASI_Mm02_00335729 predicted 823
4 SASI_Mm02_00335730 predicted 500
5 SASI_Mm02_00335731 predicted 400
6 SASI_Mm02_00335732 predicted 277
7 SASI_Mm02_00335733 predicted 822
8 SASI_Mm02_00335734 predicted 409
9 SASI_Mm02_00335735 predicted 339
10 SASI_Mm02_00335736 predicted 621
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029688
VALIDATED
SRXN1 MISSION shRNA Bacterial Glycerol Stock
sulfiredoxin 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029688.2-2086s1c1
Sequence:CCGGCCTTTAAGTAACGGTTCTCAACTCGAGTTGAGAACCGTTACTTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029688.2-278s1c1
Sequence:CCGGTGGCGACTACTACTATTCCTTCTCGAGAAGGAATAGTAGTAGTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029688.2-338s1c1
Sequence:CCGGGAGAGAGACCATTCCTGCCAACTCGAGTTGGCAGGAATGGTCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029688.2-403s1c1
Sequence:CCGGCATCCACACCAGACTTGCAATCTCGAGATTGCAAGTCTGGTGTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029688.2-140s1c1
Sequence:CCGGCGTACCAATCGCCGTGCTCATCTCGAGATGAGCACGGCGATTGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029688.4-125s21c1
Sequence:CCGGCACGGTGCACAACGTACCAATCTCGAGATTGGTACGTTGTGCACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029688.4-516s21c1
Sequence:CCGGATGGGATATGTTCTCTTTATTCTCGAGAATAAAGAGAACATATCCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029688
VALIDATED
SRXN1 MISSION shRNA shRNA Plasmid DNA
sulfiredoxin 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029688.2-2086s1c1
Sequence:CCGGCCTTTAAGTAACGGTTCTCAACTCGAGTTGAGAACCGTTACTTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029688.2-278s1c1
Sequence:CCGGTGGCGACTACTACTATTCCTTCTCGAGAAGGAATAGTAGTAGTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029688.2-338s1c1
Sequence:CCGGGAGAGAGACCATTCCTGCCAACTCGAGTTGGCAGGAATGGTCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029688.2-403s1c1
Sequence:CCGGCATCCACACCAGACTTGCAATCTCGAGATTGCAAGTCTGGTGTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029688.2-140s1c1
Sequence:CCGGCGTACCAATCGCCGTGCTCATCTCGAGATGAGCACGGCGATTGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029688.4-125s21c1
Sequence:CCGGCACGGTGCACAACGTACCAATCTCGAGATTGGTACGTTGTGCACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029688.4-516s21c1
Sequence:CCGGATGGGATATGTTCTCTTTATTCTCGAGAATAAAGAGAACATATCCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029688
VALIDATED
SRXN1 MISSION shRNA Lentiviral Transduction Particles
sulfiredoxin 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029688.2-2086s1c1
Sequence:CCGGCCTTTAAGTAACGGTTCTCAACTCGAGTTGAGAACCGTTACTTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029688.2-278s1c1
Sequence:CCGGTGGCGACTACTACTATTCCTTCTCGAGAAGGAATAGTAGTAGTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029688.2-338s1c1
Sequence:CCGGGAGAGAGACCATTCCTGCCAACTCGAGTTGGCAGGAATGGTCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029688.2-403s1c1
Sequence:CCGGCATCCACACCAGACTTGCAATCTCGAGATTGCAAGTCTGGTGTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029688.2-140s1c1
Sequence:CCGGCGTACCAATCGCCGTGCTCATCTCGAGATGAGCACGGCGATTGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029688.4-125s21c1
Sequence:CCGGCACGGTGCACAACGTACCAATCTCGAGATTGGTACGTTGTGCACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029688.4-516s21c1
Sequence:CCGGATGGGATATGTTCTCTTTATTCTCGAGAATAAAGAGAACATATCCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080725
SRXN1 MISSION shRNA Bacterial Glycerol Stock
sulfiredoxin 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080725.1-321s1c1
Sequence:CCGGCCCAGGGAGGTGACTACTTCTCTCGAGAGAAGTAGTCACCTCCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080725.1-417s1c1
Sequence:CCGGAGTCCACTCTCTCAGACCTAACTCGAGTTAGGTCTGAGAGAGTGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080725.1-190s1c1
Sequence:CCGGCGTGCCGCTGAGCGTGCTCATCTCGAGATGAGCACGCTCAGCGGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080725.1-424s1c1
Sequence:CCGGTCTCTCAGACCTAAGGGTGTACTCGAGTACACCCTTAGGTCTGAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080725.1-295s1c1
Sequence:CCGGCATCGATGTCCTCTGGATCAACTCGAGTTGATCCAGAGGACATCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080725.1-900s21c1
Sequence:CCGGTCTGGAGATGGGTGGCTAATGCTCGAGCATTAGCCACCCATCTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080725.1-458s21c1
Sequence:CCGGACACCAGACTTGCAGTAGCAGCTCGAGCTGCTACTGCAAGTCTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080725
SRXN1 MISSION shRNA shRNA Plasmid DNA
sulfiredoxin 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080725.1-321s1c1
Sequence:CCGGCCCAGGGAGGTGACTACTTCTCTCGAGAGAAGTAGTCACCTCCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080725.1-417s1c1
Sequence:CCGGAGTCCACTCTCTCAGACCTAACTCGAGTTAGGTCTGAGAGAGTGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080725.1-190s1c1
Sequence:CCGGCGTGCCGCTGAGCGTGCTCATCTCGAGATGAGCACGCTCAGCGGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080725.1-424s1c1
Sequence:CCGGTCTCTCAGACCTAAGGGTGTACTCGAGTACACCCTTAGGTCTGAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080725.1-295s1c1
Sequence:CCGGCATCGATGTCCTCTGGATCAACTCGAGTTGATCCAGAGGACATCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080725.1-900s21c1
Sequence:CCGGTCTGGAGATGGGTGGCTAATGCTCGAGCATTAGCCACCCATCTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080725.1-458s21c1
Sequence:CCGGACACCAGACTTGCAGTAGCAGCTCGAGCTGCTACTGCAAGTCTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080725
SRXN1 MISSION shRNA Lentiviral Transduction Particles
sulfiredoxin 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080725.1-321s1c1
Sequence:CCGGCCCAGGGAGGTGACTACTTCTCTCGAGAGAAGTAGTCACCTCCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080725.1-417s1c1
Sequence:CCGGAGTCCACTCTCTCAGACCTAACTCGAGTTAGGTCTGAGAGAGTGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080725.1-190s1c1
Sequence:CCGGCGTGCCGCTGAGCGTGCTCATCTCGAGATGAGCACGCTCAGCGGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080725.1-424s1c1
Sequence:CCGGTCTCTCAGACCTAAGGGTGTACTCGAGTACACCCTTAGGTCTGAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080725.1-295s1c1
Sequence:CCGGCATCGATGTCCTCTGGATCAACTCGAGTTGATCCAGAGGACATCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080725.1-900s21c1
Sequence:CCGGTCTGGAGATGGGTGGCTAATGCTCGAGCATTAGCCACCCATCTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080725.1-458s21c1
Sequence:CCGGACACCAGACTTGCAGTAGCAGCTCGAGCTGCTACTGCAAGTCTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks