EMAIL THIS PAGE TO A FRIEND

SRY

sex determining region Y

Synonyms: SRXX1 SRXY1 TDF TDY
UniProtKB ID: Q05066
Gene ID:
Human(6736) Summary: This intronless gene encodes a transcription factor that is a member of the high mobility group (HMG)-box family of DNA-binding proteins. This protein is the testis-determining factor (TDF), which initiates male sex determination. Mutations in this gene give rise to XY females with gonadal dysgenesis (Swyer syndrome); translocation of part of the Y chromosome containing this gene to the X chromosome causes XX male syndrome. [provided by RefSeq, Jul 2008]
Mouse(21674) sex determining region of Chr Y
Rat(25221) sex determining region Y
domestic cat(493758) sex determining region Y
Horse(100033824) sex determining region Y
Domestic Rabbit(100328958) sex determining region Y
cow(280931) sex determining region Y
sheep(100529253) sex determining region Y
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003140 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003140 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003140 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011564 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011564 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011564 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002121 MISSION® esiRNA esiRNA targeting human SRY (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003140 Rosetta Predictions human pricing
NM_012772 Rosetta Predictions rat pricing
NM_011564 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335138 predicted 470
2 SASI_Hs01_00211279 predicted 255
3 SASI_Hs01_00211280 predicted 633
4 SASI_Hs02_00335139 predicted 280
5 SASI_Hs01_00211281 predicted 262
6 SASI_Hs01_00211282 predicted 498
7 SASI_Hs01_00211283 predicted 368
8 SASI_Hs01_00211284 predicted 569
9 SASI_Hs01_00211285 predicted 591
10 SASI_Hs01_00211286 predicted 654
11 SASI_Hs01_00211287 predicted 488
12 SASI_Hs01_00211288 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012772 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260151 predicted 200
2 SASI_Rn02_00260152 predicted 196
3 SASI_Rn02_00260153 predicted 201
4 SASI_Rn02_00260154 predicted 207
5 SASI_Rn02_00260155 predicted 56
6 SASI_Rn02_00260156 predicted 256
7 SASI_Rn02_00260157 predicted 251
8 SASI_Rn02_00260158 predicted 308
9 SASI_Rn02_00260159 predicted 224
10 SASI_Rn02_00260160 predicted 186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186075 predicted 199
2 SASI_Mm01_00186076 predicted 202
3 SASI_Mm01_00186077 predicted 197
4 SASI_Mm01_00186078 predicted 196
5 SASI_Mm01_00186079 predicted 103
6 SASI_Mm01_00186080 predicted 223
7 SASI_Mm01_00186081 predicted 235
8 SASI_Mm01_00186082 predicted 175
9 SASI_Mm01_00186083 predicted 217
10 SASI_Mm01_00186084 predicted 1110
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003140
SRY MISSION shRNA Bacterial Glycerol Stock
sex determining region Y
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003140.1-598s21c1
Sequence:CCGGTTCGGTACTCTGCAGCGAAGTCTCGAGACTTCGCTGCAGAGTACCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003140.1-383s21c1
Sequence:CCGGGCTCTAGAGAATCCCAGAATGCTCGAGCATTCTGGGATTCTCTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003140.1-322s21c1
Sequence:CCGGTAGAGTGAAGCGACCCATGAACTCGAGTTCATGGGTCGCTTCACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003140.1-508s1c1
Sequence:CCGGCAGAGAGAAATACCCGAATTACTCGAGTAATTCGGGTATTTCTCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003140.1-178s1c1
Sequence:CCGGCGTATTCAACAGCGATGATTACTCGAGTAATCATCGCTGTTGAATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003140.1-260s1c1
Sequence:CCGGGAAAGCTGTAACTCTAAGTATCTCGAGATACTTAGAGTTACAGCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003140.1-559s1c1
Sequence:CCGGGCTGCCGAAGAATTGCAGTTTCTCGAGAAACTGCAATTCTTCGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003140.1-668s1c1
Sequence:CCGGTCAAGAATGGAGCACCAGCTACTCGAGTAGCTGGTGCTCCATTCTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003140
SRY MISSION shRNA shRNA Plasmid DNA
sex determining region Y
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003140.1-598s21c1
Sequence:CCGGTTCGGTACTCTGCAGCGAAGTCTCGAGACTTCGCTGCAGAGTACCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003140.1-383s21c1
Sequence:CCGGGCTCTAGAGAATCCCAGAATGCTCGAGCATTCTGGGATTCTCTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003140.1-322s21c1
Sequence:CCGGTAGAGTGAAGCGACCCATGAACTCGAGTTCATGGGTCGCTTCACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003140.1-508s1c1
Sequence:CCGGCAGAGAGAAATACCCGAATTACTCGAGTAATTCGGGTATTTCTCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003140.1-178s1c1
Sequence:CCGGCGTATTCAACAGCGATGATTACTCGAGTAATCATCGCTGTTGAATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003140.1-260s1c1
Sequence:CCGGGAAAGCTGTAACTCTAAGTATCTCGAGATACTTAGAGTTACAGCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003140.1-559s1c1
Sequence:CCGGGCTGCCGAAGAATTGCAGTTTCTCGAGAAACTGCAATTCTTCGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003140.1-668s1c1
Sequence:CCGGTCAAGAATGGAGCACCAGCTACTCGAGTAGCTGGTGCTCCATTCTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003140
SRY MISSION shRNA Lentiviral Transduction Particles
sex determining region Y
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003140.1-598s21c1
Sequence:CCGGTTCGGTACTCTGCAGCGAAGTCTCGAGACTTCGCTGCAGAGTACCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003140.1-383s21c1
Sequence:CCGGGCTCTAGAGAATCCCAGAATGCTCGAGCATTCTGGGATTCTCTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003140.1-322s21c1
Sequence:CCGGTAGAGTGAAGCGACCCATGAACTCGAGTTCATGGGTCGCTTCACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003140.1-508s1c1
Sequence:CCGGCAGAGAGAAATACCCGAATTACTCGAGTAATTCGGGTATTTCTCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003140.1-178s1c1
Sequence:CCGGCGTATTCAACAGCGATGATTACTCGAGTAATCATCGCTGTTGAATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003140.1-260s1c1
Sequence:CCGGGAAAGCTGTAACTCTAAGTATCTCGAGATACTTAGAGTTACAGCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003140.1-559s1c1
Sequence:CCGGGCTGCCGAAGAATTGCAGTTTCTCGAGAAACTGCAATTCTTCGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003140.1-668s1c1
Sequence:CCGGTCAAGAATGGAGCACCAGCTACTCGAGTAGCTGGTGCTCCATTCTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011564
SRY MISSION shRNA Bacterial Glycerol Stock
sex determining region Y
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011564.1-270s21c1
Sequence:CCGGGCCTGCAGTTGCCTCAACAAACTCGAGTTTGTTGAGGCAACTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011564.1-74s21c1
Sequence:CCGGAGCAGAATCCCAGCATGCAAACTCGAGTTTGCATGCTGGGATTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011564.1-560s21c1
Sequence:CCGGAGCAGAAGCAGCAGTTTCATGCTCGAGCATGAAACTGCTGCTTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011564.1-195s1c1
Sequence:CCGGCAGAGAGAAATACCCAAACTACTCGAGTAGTTTGGGTATTTCTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011564.1-318s1c1
Sequence:CCGGGAACCCACATGCCATCACATACTCGAGTATGTGATGGCATGTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011564.1-196s1c1
Sequence:CCGGAGAGAGAAATACCCAAACTATCTCGAGATAGTTTGGGTATTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011564.1-483s1c1
Sequence:CCGGGCAACAGCAGTTCTATGACCACTCGAGTGGTCATAGAACTGCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011564.1-208s1c1
Sequence:CCGGCCAAACTATAAATATCAGCCTCTCGAGAGGCTGATATTTATAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011564
SRY MISSION shRNA shRNA Plasmid DNA
sex determining region Y
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011564.1-270s21c1
Sequence:CCGGGCCTGCAGTTGCCTCAACAAACTCGAGTTTGTTGAGGCAACTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011564.1-74s21c1
Sequence:CCGGAGCAGAATCCCAGCATGCAAACTCGAGTTTGCATGCTGGGATTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011564.1-560s21c1
Sequence:CCGGAGCAGAAGCAGCAGTTTCATGCTCGAGCATGAAACTGCTGCTTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011564.1-195s1c1
Sequence:CCGGCAGAGAGAAATACCCAAACTACTCGAGTAGTTTGGGTATTTCTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011564.1-318s1c1
Sequence:CCGGGAACCCACATGCCATCACATACTCGAGTATGTGATGGCATGTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011564.1-196s1c1
Sequence:CCGGAGAGAGAAATACCCAAACTATCTCGAGATAGTTTGGGTATTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011564.1-483s1c1
Sequence:CCGGGCAACAGCAGTTCTATGACCACTCGAGTGGTCATAGAACTGCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011564.1-208s1c1
Sequence:CCGGCCAAACTATAAATATCAGCCTCTCGAGAGGCTGATATTTATAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011564
SRY MISSION shRNA Lentiviral Transduction Particles
sex determining region Y
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011564.1-270s21c1
Sequence:CCGGGCCTGCAGTTGCCTCAACAAACTCGAGTTTGTTGAGGCAACTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011564.1-74s21c1
Sequence:CCGGAGCAGAATCCCAGCATGCAAACTCGAGTTTGCATGCTGGGATTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011564.1-560s21c1
Sequence:CCGGAGCAGAAGCAGCAGTTTCATGCTCGAGCATGAAACTGCTGCTTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011564.1-195s1c1
Sequence:CCGGCAGAGAGAAATACCCAAACTACTCGAGTAGTTTGGGTATTTCTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011564.1-318s1c1
Sequence:CCGGGAACCCACATGCCATCACATACTCGAGTATGTGATGGCATGTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011564.1-196s1c1
Sequence:CCGGAGAGAGAAATACCCAAACTATCTCGAGATAGTTTGGGTATTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011564.1-483s1c1
Sequence:CCGGGCAACAGCAGTTCTATGACCACTCGAGTGGTCATAGAACTGCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011564.1-208s1c1
Sequence:CCGGCCAAACTATAAATATCAGCCTCTCGAGAGGCTGATATTTATAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks