EMAIL THIS PAGE TO A FRIEND

SS18

synovial sarcoma translocation, chromosome 18

Synonyms: SSXT SYT
UniProtKB ID: Q15532, B0YJ95, Q16404, Q4VAX1, Q9BXC6
Gene ID:
Mouse(268996) synovial sarcoma translocation, Chromosome 18
Rat(361295) synovial sarcoma translocation, Chromosome 18
Zebrafish(326668) synovial sarcoma translocation, chromosome 18 (H. sapiens)
dog(480171) synovial sarcoma translocation, chromosome 18
domestic cat(101082444) synovial sarcoma translocation, chromosome 18
chicken(421085) synovial sarcoma translocation, chromosome 18
cow(540947) synovial sarcoma translocation, chromosome 18
sheep(101117893) synovial sarcoma translocation, chromosome 18
domestic guinea pig(100715904) synovial sarcoma translocation, chromosome 18
197 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005637 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005637 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005637 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009280 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009280 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009280 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007559 Rosetta Predictions human pricing
NM_005637 Rosetta Predictions human pricing
NM_001100900 Rosetta Predictions rat pricing
NM_009280 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146407 predicted 251
2 SASI_Hs01_00146408 predicted 257
3 SASI_Hs01_00146409 predicted 214
4 SASI_Hs01_00146410 predicted 201
5 SASI_Hs01_00146411 predicted 496
6 SASI_Hs01_00146412 predicted 235
7 SASI_Hs01_00146413 predicted 245
8 SASI_Hs01_00146414 predicted 676
9 SASI_Hs02_00305345 predicted 508
10 SASI_Hs01_00146415 predicted 1363
11 SASI_Hs01_00146406 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220147 predicted 249
2 SASI_Hs01_00220148 predicted 257
3 SASI_Hs01_00220149 predicted 211
4 SASI_Hs01_00220150 predicted 195
5 SASI_Hs01_00220151 predicted 490
6 SASI_Hs01_00220152 predicted 236
7 SASI_Hs01_00220153 predicted 240
8 SASI_Hs01_00220154 predicted 681
9 SASI_Hs02_00339974 predicted 503
10 SASI_Hs01_00220155 predicted 1270
11 SASI_Hs01_00220146 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100900 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210702 predicted 1434
2 SASI_Rn02_00210703 predicted 922
3 SASI_Rn02_00210704 predicted 1327
4 SASI_Rn02_00210705 predicted 1467
5 SASI_Rn02_00210706 predicted 238
6 SASI_Rn02_00210707 predicted 902
7 SASI_Rn02_00210708 predicted 985
8 SASI_Rn02_00210709 predicted 1286
9 SASI_Rn02_00210710 predicted 1181
10 SASI_Rn02_00210711 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009280 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146021 predicted 1129
2 SASI_Mm01_00146022 predicted 262
3 SASI_Mm02_00315776 predicted 1038
4 SASI_Mm01_00146023 predicted 1050
5 SASI_Mm02_00315777 predicted 1159
6 SASI_Mm01_00146025 predicted 1031
7 SASI_Mm02_00315778 predicted 1056
8 SASI_Mm02_00315779 predicted 254
9 SASI_Mm01_00146028 predicted 1112
10 SASI_Mm01_00146029 predicted 1306
11 SASI_Mm01_00146024 predicted 362
12 SASI_Mm01_00146026 predicted 620
13 SASI_Mm01_00146027 predicted 623
14 SASI_Mm01_00146030 predicted 1151
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005637
SS18 MISSION shRNA Bacterial Glycerol Stock
synovial sarcoma translocation, chromosome 18
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005637.1-168s1c1
Sequence:CCGGGCAGATGTTGCACACAAACTTCTCGAGAAGTTTGTGTGCAACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005637.1-643s1c1
Sequence:CCGGCCTCCTTCTCAGCAATACAATCTCGAGATTGTATTGCTGAGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005637.1-865s1c1
Sequence:CCGGGAAGGCATGAACCAGCAATATCTCGAGATATTGCTGGTTCATGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005637.1-427s1c1
Sequence:CCGGCCTGGACCCAATCAACTCAATCTCGAGATTGAGTTGATTGGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005637.1-1073s1c1
Sequence:CCGGGTCAGCAGTATGGAGGATATACTCGAGTATATCCTCCATACTGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005637.2-456s21c1
Sequence:CCGGGATGCCTGGGCCTAACCATATCTCGAGATATGGTTAGGCCCAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005637.2-251s21c1
Sequence:CCGGTGGTATACCTTGCTACAATAGCTCGAGCTATTGTAGCAAGGTATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005637.2-774s21c1
Sequence:CCGGGGGAATGATGGGTCAAGTTAACTCGAGTTAACTTGACCCATCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005637
SS18 MISSION shRNA shRNA Plasmid DNA
synovial sarcoma translocation, chromosome 18
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005637.1-168s1c1
Sequence:CCGGGCAGATGTTGCACACAAACTTCTCGAGAAGTTTGTGTGCAACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005637.1-643s1c1
Sequence:CCGGCCTCCTTCTCAGCAATACAATCTCGAGATTGTATTGCTGAGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005637.1-865s1c1
Sequence:CCGGGAAGGCATGAACCAGCAATATCTCGAGATATTGCTGGTTCATGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005637.1-427s1c1
Sequence:CCGGCCTGGACCCAATCAACTCAATCTCGAGATTGAGTTGATTGGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005637.1-1073s1c1
Sequence:CCGGGTCAGCAGTATGGAGGATATACTCGAGTATATCCTCCATACTGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005637.2-456s21c1
Sequence:CCGGGATGCCTGGGCCTAACCATATCTCGAGATATGGTTAGGCCCAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005637.2-251s21c1
Sequence:CCGGTGGTATACCTTGCTACAATAGCTCGAGCTATTGTAGCAAGGTATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005637.2-774s21c1
Sequence:CCGGGGGAATGATGGGTCAAGTTAACTCGAGTTAACTTGACCCATCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005637
SS18 MISSION shRNA Lentiviral Transduction Particles
synovial sarcoma translocation, chromosome 18
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005637.1-168s1c1
Sequence:CCGGGCAGATGTTGCACACAAACTTCTCGAGAAGTTTGTGTGCAACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005637.1-643s1c1
Sequence:CCGGCCTCCTTCTCAGCAATACAATCTCGAGATTGTATTGCTGAGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005637.1-865s1c1
Sequence:CCGGGAAGGCATGAACCAGCAATATCTCGAGATATTGCTGGTTCATGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005637.1-427s1c1
Sequence:CCGGCCTGGACCCAATCAACTCAATCTCGAGATTGAGTTGATTGGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005637.1-1073s1c1
Sequence:CCGGGTCAGCAGTATGGAGGATATACTCGAGTATATCCTCCATACTGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005637.2-456s21c1
Sequence:CCGGGATGCCTGGGCCTAACCATATCTCGAGATATGGTTAGGCCCAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005637.2-251s21c1
Sequence:CCGGTGGTATACCTTGCTACAATAGCTCGAGCTATTGTAGCAAGGTATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005637.2-774s21c1
Sequence:CCGGGGGAATGATGGGTCAAGTTAACTCGAGTTAACTTGACCCATCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009280
VALIDATED
SS18 MISSION shRNA Bacterial Glycerol Stock
synovial sarcoma translocation, chromosome 18
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009280.1-625s1c1
Sequence:CCGGCCATGAATATGCCTTCAAGTACTCGAGTACTTGAAGGCATATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009280.1-319s1c1
Sequence:CCGGGCTCGCAGTATCAGCAGATATCTCGAGATATCTGCTGATACTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009280.1-1058s1c1
Sequence:CCGGTGGTCATAATGATTACGGTTACTCGAGTAACCGTAATCATTATGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009280.1-1116s1c1
Sequence:CCGGCCTTATGAGGATTCCTCACAACTCGAGTTGTGAGGAATCCTCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009280.1-2722s1c1
Sequence:CCGGCCAGGGAATATGACTGAATATCTCGAGATATTCAGTCATATTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009280.2-1075s21c1
Sequence:CCGGGTTATCAGCAACCGTCGTATCCTCGAGGATACGACGGTTGCTGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009280.1-625s21c1
Sequence:CCGGCCATGAATATGCCTTCAAGTACTCGAGTACTTGAAGGCATATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009280.1-1785s21c1
Sequence:CCGGCATACTTCTCCACCGATTATTCTCGAGAATAATCGGTGGAGAAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009280.1-1094s21c1
Sequence:CCGGTCCTGAACAAGGCTACGATAGCTCGAGCTATCGTAGCCTTGTTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009280.1-1138s21c1
Sequence:CCGGATTACTACGAAGGAGGAAACTCTCGAGAGTTTCCTCCTTCGTAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009280.1-319s21c1
Sequence:CCGGGCTCGCAGTATCAGCAGATATCTCGAGATATCTGCTGATACTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009280.2-1121s21c1
Sequence:CCGGTGAGGATTCCTCACAACATTACTCGAGTAATGTTGTGAGGAATCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009280.2-1047s21c1
Sequence:CCGGTATTACCCTGATGGTCATAATCTCGAGATTATGACCATCAGGGTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009280
VALIDATED
SS18 MISSION shRNA shRNA Plasmid DNA
synovial sarcoma translocation, chromosome 18
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009280.1-625s1c1
Sequence:CCGGCCATGAATATGCCTTCAAGTACTCGAGTACTTGAAGGCATATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009280.1-319s1c1
Sequence:CCGGGCTCGCAGTATCAGCAGATATCTCGAGATATCTGCTGATACTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009280.1-1058s1c1
Sequence:CCGGTGGTCATAATGATTACGGTTACTCGAGTAACCGTAATCATTATGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009280.1-1116s1c1
Sequence:CCGGCCTTATGAGGATTCCTCACAACTCGAGTTGTGAGGAATCCTCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009280.1-2722s1c1
Sequence:CCGGCCAGGGAATATGACTGAATATCTCGAGATATTCAGTCATATTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009280.2-1075s21c1
Sequence:CCGGGTTATCAGCAACCGTCGTATCCTCGAGGATACGACGGTTGCTGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009280.1-625s21c1
Sequence:CCGGCCATGAATATGCCTTCAAGTACTCGAGTACTTGAAGGCATATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009280.1-1785s21c1
Sequence:CCGGCATACTTCTCCACCGATTATTCTCGAGAATAATCGGTGGAGAAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009280.1-1094s21c1
Sequence:CCGGTCCTGAACAAGGCTACGATAGCTCGAGCTATCGTAGCCTTGTTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009280.1-1138s21c1
Sequence:CCGGATTACTACGAAGGAGGAAACTCTCGAGAGTTTCCTCCTTCGTAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009280.1-319s21c1
Sequence:CCGGGCTCGCAGTATCAGCAGATATCTCGAGATATCTGCTGATACTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009280.2-1121s21c1
Sequence:CCGGTGAGGATTCCTCACAACATTACTCGAGTAATGTTGTGAGGAATCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009280.2-1047s21c1
Sequence:CCGGTATTACCCTGATGGTCATAATCTCGAGATTATGACCATCAGGGTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009280
VALIDATED
SS18 MISSION shRNA Lentiviral Transduction Particles
synovial sarcoma translocation, chromosome 18
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009280.1-625s1c1
Sequence:CCGGCCATGAATATGCCTTCAAGTACTCGAGTACTTGAAGGCATATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009280.1-319s1c1
Sequence:CCGGGCTCGCAGTATCAGCAGATATCTCGAGATATCTGCTGATACTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009280.1-1058s1c1
Sequence:CCGGTGGTCATAATGATTACGGTTACTCGAGTAACCGTAATCATTATGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009280.1-1116s1c1
Sequence:CCGGCCTTATGAGGATTCCTCACAACTCGAGTTGTGAGGAATCCTCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009280.1-2722s1c1
Sequence:CCGGCCAGGGAATATGACTGAATATCTCGAGATATTCAGTCATATTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009280.2-1075s21c1
Sequence:CCGGGTTATCAGCAACCGTCGTATCCTCGAGGATACGACGGTTGCTGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009280.1-625s21c1
Sequence:CCGGCCATGAATATGCCTTCAAGTACTCGAGTACTTGAAGGCATATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009280.1-1785s21c1
Sequence:CCGGCATACTTCTCCACCGATTATTCTCGAGAATAATCGGTGGAGAAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009280.1-1094s21c1
Sequence:CCGGTCCTGAACAAGGCTACGATAGCTCGAGCTATCGTAGCCTTGTTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009280.1-1138s21c1
Sequence:CCGGATTACTACGAAGGAGGAAACTCTCGAGAGTTTCCTCCTTCGTAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009280.1-319s21c1
Sequence:CCGGGCTCGCAGTATCAGCAGATATCTCGAGATATCTGCTGATACTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009280.2-1121s21c1
Sequence:CCGGTGAGGATTCCTCACAACATTACTCGAGTAATGTTGTGAGGAATCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009280.2-1047s21c1
Sequence:CCGGTATTACCCTGATGGTCATAATCTCGAGATTATGACCATCAGGGTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks