EMAIL THIS PAGE TO A FRIEND

SS18L1

synovial sarcoma translocation gene on chromosome 18-like 1

Synonyms: CREST LP2261
Gene ID:
Human(26039) Summary: Synovial sarcomas occur most frequently in the extremities around large joints. More than 90% of cases have a recurrent and specific chromosomal translocation, t(X;18)(p11.2;q11.2), in which the 5-prime end of the SS18 gene (MIM 600192) is fused in-frame to the 3-prime end of the SSX1 (MIM 312820), SSX2 (MIM 300192), or SSX4 (MIM 300326) gene. The SS18L1 gene is homologous to SS18.[supplied by OMIM, Jul 2002]
Mouse(269397) synovial sarcoma translocation gene on chromosome 18-like 1
Rat(192352) synovial sarcoma translocation gene on chromosome 18-like 1
cow(768207) synovial sarcoma translocation gene on chromosome 18-like 1
sheep(101113515) synovial sarcoma translocation gene on chromosome 18-like 1
domestic guinea pig(100719932) synovial sarcoma translocation gene on chromosome 18-like 1
naked mole-rat(101698052) synovial sarcoma translocation gene on chromosome 18-like 1
chicken(419225) synovial sarcoma translocation gene on chromosome 18-like 1
domestic cat(101097470) synovial sarcoma translocation gene on chromosome 18-like 1
dog(485958) synovial sarcoma translocation gene on chromosome 18-like 1
151 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198935 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198935 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198935 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178750 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178750 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178750 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015558 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015558 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015558 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015558 Rosetta Predictions human pricing
NM_198935 Rosetta Predictions human pricing
NM_138918 Rosetta Predictions rat pricing
NM_178750 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138794 predicted 893
2 SASI_Hs01_00138795 predicted 614
3 SASI_Hs01_00138796 predicted 1617
4 SASI_Hs01_00138797 predicted 887
5 SASI_Hs01_00138798 predicted 488
6 SASI_Hs01_00138799 predicted 584
7 SASI_Hs01_00138800 predicted 553
8 SASI_Hs01_00138801 predicted 941
9 SASI_Hs01_00138802 predicted 1621
10 SASI_Hs01_00138803 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372431 predicted 1655
2 SASI_Hs02_00372432 predicted 1310
3 SASI_Hs02_00372433 predicted 1373
4 SASI_Hs01_00200478 predicted 892
5 SASI_Hs01_00200483 predicted 574
6 SASI_Hs02_00372434 predicted 1639
7 SASI_Hs02_00372435 predicted 1365
8 SASI_Hs02_00372436 predicted 1612
9 SASI_Hs01_00200484 predicted 554
10 SASI_Hs01_00200485 predicted 942
11 SASI_Hs01_00200477 predicted 576
12 SASI_Hs01_00200479 predicted 604
13 SASI_Hs01_00200480 predicted 364
14 SASI_Hs01_00200481 predicted 889
15 SASI_Hs01_00200482 predicted 489
16 SASI_Hs01_00200486 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138918 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100777 predicted 526
2 SASI_Rn01_00100778 predicted 428
3 SASI_Rn01_00100779 predicted 317
4 SASI_Rn01_00100780 predicted 547
5 SASI_Rn01_00100781 predicted 722
6 SASI_Rn01_00100782 predicted 546
7 SASI_Rn01_00100783 predicted 581
8 SASI_Rn02_00268404 predicted 414
9 SASI_Rn01_00100784 predicted 367
10 SASI_Rn01_00100785 predicted 242
11 SASI_Rn01_00100776 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038971 predicted 1508
2 SASI_Mm01_00038972 predicted 1488
3 SASI_Mm01_00038973 predicted 855
4 SASI_Mm01_00038974 predicted 1451
5 SASI_Mm01_00038975 predicted 1171
6 SASI_Mm01_00038976 predicted 1551
7 SASI_Mm01_00038977 predicted 1506
8 SASI_Mm01_00038978 predicted 1131
9 SASI_Mm01_00038979 predicted 887
10 SASI_Mm01_00038980 predicted 1279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198935
SS18L1 MISSION shRNA Bacterial Glycerol Stock
synovial sarcoma translocation gene on chromosome 18-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198935.1-579s21c1
Sequence:CCGGCTCGGACCAACATCAACATGCCTCGAGGCATGTTGATGTTGGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198935.1-945s21c1
Sequence:CCGGAGTCCACGCAGCACTACTATGCTCGAGCATAGTAGTGCTGCGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198935.1-1227s21c1
Sequence:CCGGATGGAAATTACCAGCAGTAAGCTCGAGCTTACTGCTGGTAATTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198935.1-4075s21c1
Sequence:GTACCGGCAACAGTACTCAGCATATTAACTCGAGTTAATATGCTGAGTACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198935.1-805s21c1
Sequence:CCGGGGAGTACTATGGCGAGCAGTACTCGAGTACTGCTCGCCATAGTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198935
SS18L1 MISSION shRNA shRNA Plasmid DNA
synovial sarcoma translocation gene on chromosome 18-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198935.1-579s21c1
Sequence:CCGGCTCGGACCAACATCAACATGCCTCGAGGCATGTTGATGTTGGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198935.1-945s21c1
Sequence:CCGGAGTCCACGCAGCACTACTATGCTCGAGCATAGTAGTGCTGCGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198935.1-1227s21c1
Sequence:CCGGATGGAAATTACCAGCAGTAAGCTCGAGCTTACTGCTGGTAATTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198935.1-4075s21c1
Sequence:GTACCGGCAACAGTACTCAGCATATTAACTCGAGTTAATATGCTGAGTACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198935.1-805s21c1
Sequence:CCGGGGAGTACTATGGCGAGCAGTACTCGAGTACTGCTCGCCATAGTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198935
SS18L1 MISSION shRNA Lentiviral Transduction Particles
synovial sarcoma translocation gene on chromosome 18-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198935.1-579s21c1
Sequence:CCGGCTCGGACCAACATCAACATGCCTCGAGGCATGTTGATGTTGGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198935.1-945s21c1
Sequence:CCGGAGTCCACGCAGCACTACTATGCTCGAGCATAGTAGTGCTGCGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198935.1-1227s21c1
Sequence:CCGGATGGAAATTACCAGCAGTAAGCTCGAGCTTACTGCTGGTAATTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198935.1-4075s21c1
Sequence:GTACCGGCAACAGTACTCAGCATATTAACTCGAGTTAATATGCTGAGTACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198935.1-805s21c1
Sequence:CCGGGGAGTACTATGGCGAGCAGTACTCGAGTACTGCTCGCCATAGTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178750
SS18L1 MISSION shRNA Bacterial Glycerol Stock
synovial sarcoma translocation gene on chromosome 18-like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178750.4-480s1c1
Sequence:CCGGCATAGCAGACTCCAATCAGAACTCGAGTTCTGATTGGAGTCTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202387    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178750.4-3107s1c1
Sequence:CCGGGCCGTCTTACTCTAGGACATTCTCGAGAATGTCCTAGAGTAAGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178750.4-839s1c1
Sequence:CCGGCCAACATCAACATGCAGTCTACTCGAGTAGACTGCATGTTGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178750.4-825s1c1
Sequence:CCGGCTATGTGTCTCGGACCAACATCTCGAGATGTTGGTCCGAGACACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178750.4-1104s1c1
Sequence:CCGGGCCCATGAGTCAACAGTACTACTCGAGTAGTACTGTTGACTCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178750.4-522s1c1
Sequence:CCGGGCCTCCAACACAGAACATGAACTCGAGTTCATGTTCTGTGTTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178750.4-1397s1c1
Sequence:CCGGGTCAGCAGTATGGAAGCTACACTCGAGTGTAGCTTCCATACTGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178750.4-3585s1c1
Sequence:CCGGGCTGTGTTAGTGTGTGTTAATCTCGAGATTAACACACACTAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178750.4-840s1c1
Sequence:CCGGCAACATCAACATGCAGTCTAACTCGAGTTAGACTGCATGTTGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178750
SS18L1 MISSION shRNA shRNA Plasmid DNA
synovial sarcoma translocation gene on chromosome 18-like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178750.4-480s1c1
Sequence:CCGGCATAGCAGACTCCAATCAGAACTCGAGTTCTGATTGGAGTCTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202387    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178750.4-3107s1c1
Sequence:CCGGGCCGTCTTACTCTAGGACATTCTCGAGAATGTCCTAGAGTAAGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178750.4-839s1c1
Sequence:CCGGCCAACATCAACATGCAGTCTACTCGAGTAGACTGCATGTTGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178750.4-825s1c1
Sequence:CCGGCTATGTGTCTCGGACCAACATCTCGAGATGTTGGTCCGAGACACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178750.4-1104s1c1
Sequence:CCGGGCCCATGAGTCAACAGTACTACTCGAGTAGTACTGTTGACTCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178750.4-522s1c1
Sequence:CCGGGCCTCCAACACAGAACATGAACTCGAGTTCATGTTCTGTGTTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178750.4-1397s1c1
Sequence:CCGGGTCAGCAGTATGGAAGCTACACTCGAGTGTAGCTTCCATACTGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178750.4-3585s1c1
Sequence:CCGGGCTGTGTTAGTGTGTGTTAATCTCGAGATTAACACACACTAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178750.4-840s1c1
Sequence:CCGGCAACATCAACATGCAGTCTAACTCGAGTTAGACTGCATGTTGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178750
SS18L1 MISSION shRNA Lentiviral Transduction Particles
synovial sarcoma translocation gene on chromosome 18-like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178750.4-480s1c1
Sequence:CCGGCATAGCAGACTCCAATCAGAACTCGAGTTCTGATTGGAGTCTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202387    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178750.4-3107s1c1
Sequence:CCGGGCCGTCTTACTCTAGGACATTCTCGAGAATGTCCTAGAGTAAGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178750.4-839s1c1
Sequence:CCGGCCAACATCAACATGCAGTCTACTCGAGTAGACTGCATGTTGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178750.4-825s1c1
Sequence:CCGGCTATGTGTCTCGGACCAACATCTCGAGATGTTGGTCCGAGACACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178750.4-1104s1c1
Sequence:CCGGGCCCATGAGTCAACAGTACTACTCGAGTAGTACTGTTGACTCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178750.4-522s1c1
Sequence:CCGGGCCTCCAACACAGAACATGAACTCGAGTTCATGTTCTGTGTTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178750.4-1397s1c1
Sequence:CCGGGTCAGCAGTATGGAAGCTACACTCGAGTGTAGCTTCCATACTGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178750.4-3585s1c1
Sequence:CCGGGCTGTGTTAGTGTGTGTTAATCTCGAGATTAACACACACTAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178750.4-840s1c1
Sequence:CCGGCAACATCAACATGCAGTCTAACTCGAGTTAGACTGCATGTTGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015558
SS18L1 MISSION shRNA Bacterial Glycerol Stock
synovial sarcoma translocation gene on chromosome 18-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015558.3-3025s1c1
Sequence:CCGGCCAACATGAATTGTTTGTGAACTCGAGTTCACAAACAATTCATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015558.3-247s1c1
Sequence:CCGGCGCAGACTCCAACCAGAACATCTCGAGATGTTCTGGTTGGAGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015558.3-685s1c1
Sequence:CCGGCCAGTCGTCCATCGCCATGATCTCGAGATCATGGCGATGGACGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015558.3-139s1c1
Sequence:CCGGCCACCACCTGATCCAGTGCATCTCGAGATGCACTGGATCAGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015558.3-1121s1c1
Sequence:CCGGCCCGGCTACCAGCAAGGCCAACTCGAGTTGGCCTTGCTGGTAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015558
SS18L1 MISSION shRNA shRNA Plasmid DNA
synovial sarcoma translocation gene on chromosome 18-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015558.3-3025s1c1
Sequence:CCGGCCAACATGAATTGTTTGTGAACTCGAGTTCACAAACAATTCATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015558.3-247s1c1
Sequence:CCGGCGCAGACTCCAACCAGAACATCTCGAGATGTTCTGGTTGGAGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015558.3-685s1c1
Sequence:CCGGCCAGTCGTCCATCGCCATGATCTCGAGATCATGGCGATGGACGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015558.3-139s1c1
Sequence:CCGGCCACCACCTGATCCAGTGCATCTCGAGATGCACTGGATCAGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015558.3-1121s1c1
Sequence:CCGGCCCGGCTACCAGCAAGGCCAACTCGAGTTGGCCTTGCTGGTAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015558
SS18L1 MISSION shRNA Lentiviral Transduction Particles
synovial sarcoma translocation gene on chromosome 18-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015558.3-3025s1c1
Sequence:CCGGCCAACATGAATTGTTTGTGAACTCGAGTTCACAAACAATTCATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015558.3-247s1c1
Sequence:CCGGCGCAGACTCCAACCAGAACATCTCGAGATGTTCTGGTTGGAGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015558.3-685s1c1
Sequence:CCGGCCAGTCGTCCATCGCCATGATCTCGAGATCATGGCGATGGACGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015558.3-139s1c1
Sequence:CCGGCCACCACCTGATCCAGTGCATCTCGAGATGCACTGGATCAGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015558.3-1121s1c1
Sequence:CCGGCCCGGCTACCAGCAAGGCCAACTCGAGTTGGCCTTGCTGGTAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks