EMAIL THIS PAGE TO A FRIEND

SS18L2

synovial sarcoma translocation gene on chromosome 18-like 2

Synonyms: KIAA-iso
UniProtKB ID: Q9UHA2, B2R5L1
Gene ID:
Human(51188) Summary: Synovial sarcomas occur most frequently in the extremities around large joints. More than 90% of cases have a recurrent and specific chromosomal translocation, t(X;18)(p11.2;q11.2), in which the 5-prime end of the SS18 gene (MIM 600192) is fused in-frame to the 3-prime end of the SSX1 (MIM 312820), SSX2 (MIM 300192), or SSX4 (MIM 300326) gene. The SS18L2 gene is homologous to SS18.[supplied by OMIM, Jul 2002]
Zebrafish(550446) synovial sarcoma translocation gene on chromosome 18-like 2
domestic cat(101095852) synovial sarcoma translocation gene on chromosome 18-like 2
dog(609586) synovial sarcoma translocation gene on chromosome 18-like 2
chicken(769135) synovial sarcoma translocation gene on chromosome 18-like 2
naked mole-rat(101716649) synovial sarcoma translocation gene on chromosome 18-like 2
domestic guinea pig(100735861) synovial sarcoma translocation gene on chromosome 18-like 2
cow(618689) synovial sarcoma translocation gene on chromosome 18-like 2
sheep(100270718) synovial sarcoma translocation gene on chromosome 18-like 2
33 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016305 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016305 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016305 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104931 MISSION® esiRNA esiRNA human SS18L2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016305 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090367 predicted 232
2 SASI_Hs01_00090368 predicted 218
3 SASI_Hs02_00349232 predicted 284
4 SASI_Hs01_00090369 predicted 232
5 SASI_Hs01_00090370 predicted 219
6 SASI_Hs01_00090371 predicted 249
7 SASI_Hs01_00090372 predicted 219
8 SASI_Hs01_00090374 predicted 251
9 SASI_Hs01_00090375 predicted 260
10 SASI_Hs01_00090376 predicted 213
11 SASI_Hs01_00090373 predicted 297
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016305
VALIDATED
SS18L2 MISSION shRNA Bacterial Glycerol Stock
synovial sarcoma translocation gene on chromosome 18-like 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016305.1-191s1c1
Sequence:CCGGGATCCGCTGTATTGTGGAGTACTCGAGTACTCCACAATACAGCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016305.1-196s1c1
Sequence:CCGGGCTGTATTGTGGAGTATCAGACTCGAGTCTGATACTCCACAATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016305.1-243s1c1
Sequence:CCGGCAGTACCAGCATGTGTTACATCTCGAGATGTAACACATGCTGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016305.1-249s1c1
Sequence:CCGGCAGCATGTGTTACATAGAAATCTCGAGATTTCTATGTAACACATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167237    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016305.1-502s1c1
Sequence:CCGGCTTAGCTGTATTCTCATGTAACTCGAGTTACATGAGAATACAGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016305.1-270s1c1
Sequence:CCGGCTCATTTATTTGGCTACCATTCTCGAGAATGGTAGCCAAATAAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016305.2-648s21c1
Sequence:CCGGAGAGGAAACTCAGTAGGTGTTCTCGAGAACACCTACTGAGTTTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016305.2-411s21c1
Sequence:CCGGGGGTCTTTACCAACTCAACTGCTCGAGCAGTTGAGTTGGTAAAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016305.2-314s21c1
Sequence:CCGGAGCAATGGAATAATCTTTCAACTCGAGTTGAAAGATTATTCCATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016305.2-378s21c1
Sequence:CCGGTGAATGTAATCCATCTCTTACCTCGAGGTAAGAGATGGATTACATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016305.2-156s21c1
Sequence:CCGGCAGCGGCTCCTTGAGGAGAATCTCGAGATTCTCCTCAAGGAGCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016305.2-337s21c1
Sequence:CCGGGCAATAGAATAATCTTCCATTCTCGAGAATGGAAGATTATTCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016305.2-531s21c1
Sequence:CCGGATTAAGCAAATCCCTCAATAACTCGAGTTATTGAGGGATTTGCTTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016305.2-131s21c1
Sequence:CCGGGGCGGAAGTCAATCAAGAGACCTCGAGGTCTCTTGATTGACTTCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016305.2-456s21c1
Sequence:CCGGTGGCTCTTTCGAAACGTGAAACTCGAGTTTCACGTTTCGAAAGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016305
VALIDATED
SS18L2 MISSION shRNA shRNA Plasmid DNA
synovial sarcoma translocation gene on chromosome 18-like 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016305.1-191s1c1
Sequence:CCGGGATCCGCTGTATTGTGGAGTACTCGAGTACTCCACAATACAGCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016305.1-196s1c1
Sequence:CCGGGCTGTATTGTGGAGTATCAGACTCGAGTCTGATACTCCACAATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016305.1-243s1c1
Sequence:CCGGCAGTACCAGCATGTGTTACATCTCGAGATGTAACACATGCTGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016305.1-249s1c1
Sequence:CCGGCAGCATGTGTTACATAGAAATCTCGAGATTTCTATGTAACACATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167237    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016305.1-502s1c1
Sequence:CCGGCTTAGCTGTATTCTCATGTAACTCGAGTTACATGAGAATACAGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016305.1-270s1c1
Sequence:CCGGCTCATTTATTTGGCTACCATTCTCGAGAATGGTAGCCAAATAAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016305.2-648s21c1
Sequence:CCGGAGAGGAAACTCAGTAGGTGTTCTCGAGAACACCTACTGAGTTTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016305.2-411s21c1
Sequence:CCGGGGGTCTTTACCAACTCAACTGCTCGAGCAGTTGAGTTGGTAAAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016305.2-314s21c1
Sequence:CCGGAGCAATGGAATAATCTTTCAACTCGAGTTGAAAGATTATTCCATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016305.2-378s21c1
Sequence:CCGGTGAATGTAATCCATCTCTTACCTCGAGGTAAGAGATGGATTACATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016305.2-156s21c1
Sequence:CCGGCAGCGGCTCCTTGAGGAGAATCTCGAGATTCTCCTCAAGGAGCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016305.2-337s21c1
Sequence:CCGGGCAATAGAATAATCTTCCATTCTCGAGAATGGAAGATTATTCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016305.2-531s21c1
Sequence:CCGGATTAAGCAAATCCCTCAATAACTCGAGTTATTGAGGGATTTGCTTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016305.2-131s21c1
Sequence:CCGGGGCGGAAGTCAATCAAGAGACCTCGAGGTCTCTTGATTGACTTCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016305.2-456s21c1
Sequence:CCGGTGGCTCTTTCGAAACGTGAAACTCGAGTTTCACGTTTCGAAAGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016305
VALIDATED
SS18L2 MISSION shRNA Lentiviral Transduction Particles
synovial sarcoma translocation gene on chromosome 18-like 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016305.1-191s1c1
Sequence:CCGGGATCCGCTGTATTGTGGAGTACTCGAGTACTCCACAATACAGCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016305.1-196s1c1
Sequence:CCGGGCTGTATTGTGGAGTATCAGACTCGAGTCTGATACTCCACAATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016305.1-243s1c1
Sequence:CCGGCAGTACCAGCATGTGTTACATCTCGAGATGTAACACATGCTGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016305.1-249s1c1
Sequence:CCGGCAGCATGTGTTACATAGAAATCTCGAGATTTCTATGTAACACATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167237    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016305.1-502s1c1
Sequence:CCGGCTTAGCTGTATTCTCATGTAACTCGAGTTACATGAGAATACAGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016305.1-270s1c1
Sequence:CCGGCTCATTTATTTGGCTACCATTCTCGAGAATGGTAGCCAAATAAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016305.2-648s21c1
Sequence:CCGGAGAGGAAACTCAGTAGGTGTTCTCGAGAACACCTACTGAGTTTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016305.2-411s21c1
Sequence:CCGGGGGTCTTTACCAACTCAACTGCTCGAGCAGTTGAGTTGGTAAAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016305.2-314s21c1
Sequence:CCGGAGCAATGGAATAATCTTTCAACTCGAGTTGAAAGATTATTCCATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016305.2-378s21c1
Sequence:CCGGTGAATGTAATCCATCTCTTACCTCGAGGTAAGAGATGGATTACATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016305.2-156s21c1
Sequence:CCGGCAGCGGCTCCTTGAGGAGAATCTCGAGATTCTCCTCAAGGAGCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016305.2-337s21c1
Sequence:CCGGGCAATAGAATAATCTTCCATTCTCGAGAATGGAAGATTATTCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016305.2-531s21c1
Sequence:CCGGATTAAGCAAATCCCTCAATAACTCGAGTTATTGAGGGATTTGCTTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016305.2-131s21c1
Sequence:CCGGGGCGGAAGTCAATCAAGAGACCTCGAGGTCTCTTGATTGACTTCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016305.2-456s21c1
Sequence:CCGGTGGCTCTTTCGAAACGTGAAACTCGAGTTTCACGTTTCGAAAGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks