EMAIL THIS PAGE TO A FRIEND

SSB

Sjogren syndrome antigen B (autoantigen La)

Synonyms: LARP3 La
UniProtKB ID: P05455, Q15367, Q53XJ4
Gene ID:
Human(6741) Summary: The protein encoded by this gene is involved in diverse aspects of RNA metabolism, including binding and protecting poly(U) termini of nascent RNA polymerase III transcripts from exonuclease digestion, processing 5' and 3' ends of pre-tRNA precursors, acting as an RNA chaperone, and binding viral RNAs associated with hepatitis C virus. Autoantibodies reacting with this protein are found in the sera of patients with Sjogren syndrome and systemic lupus erythematosus. [provided by RefSeq, Nov 2011]
Mouse(20823) Sjogren syndrome antigen B
Rat(81783) Sjogren syndrome antigen B
Zebrafish(321504) Sjogren syndrome antigen B (autoantigen La)
Horse(100052752) Sjogren syndrome antigen B (autoantigen La)
chicken(395268) Sjogren syndrome antigen B (autoantigen La)
dog(478787) Sjogren syndrome antigen B (autoantigen La)
domestic cat(101087508) Sjogren syndrome antigen B (autoantigen La)
cow(338071) Sjogren syndrome antigen B (autoantigen La)
sheep(101118333) Sjogren syndrome antigen B (autoantigen La)
domestic guinea pig(100731691) Sjogren syndrome antigen B (autoantigen La)
naked mole-rat(101724484) Sjogren syndrome antigen B (autoantigen La)
Domestic Rabbit(100008866) Sjogren syndrome antigen B (autoantigen La)
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009278 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009278 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009278 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003142 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003142 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003142 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003142 Rosetta Predictions human pricing
NM_031119 Rosetta Predictions rat pricing
NM_001110145 Rosetta Predictions mouse pricing
NM_009278 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003142 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175447 predicted 1321
2 SASI_Hs02_00335141 predicted 430
3 SASI_Hs01_00175449 predicted 946
4 SASI_Hs01_00175450 predicted 969
5 SASI_Hs02_00335142 predicted 979
6 SASI_Hs02_00335143 predicted 917
7 SASI_Hs02_00335144 predicted 1324
8 SASI_Hs01_00175453 predicted 1061
9 SASI_Hs01_00175455 predicted 974
10 SASI_Hs02_00335145 predicted 952
11 SASI_Hs01_00175446 predicted 1080
12 SASI_Hs01_00175448 predicted 437
13 SASI_Hs01_00175451 predicted 396
14 SASI_Hs01_00175452 predicted 282
15 SASI_Hs01_00175454 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031119 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119312 predicted 1104
2 SASI_Rn01_00119313 predicted 929
3 SASI_Rn01_00119314 predicted 433
4 SASI_Rn01_00119315 predicted 1068
5 SASI_Rn01_00119317 predicted 303
6 SASI_Rn01_00119320 predicted 1061
7 SASI_Rn01_00119321 predicted 964
8 SASI_Rn02_00264424 predicted 1061
9 SASI_Rn02_00264425 predicted 404
10 SASI_Rn02_00264426 predicted 321
11 SASI_Rn01_00119316 predicted 1225
12 SASI_Rn01_00119318 predicted 324
13 SASI_Rn01_00119319 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110145 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304716 predicted 1127
2 SASI_Mm02_00304717 predicted 1007
3 SASI_Mm02_00304718 predicted 1670
4 SASI_Mm02_00304719 predicted 1235
5 SASI_Mm02_00304720 predicted 1361
6 SASI_Mm02_00304721 predicted 1360
7 SASI_Mm02_00304722 predicted 1611
8 SASI_Mm02_00304723 predicted 1034
9 SASI_Mm02_00304724 predicted 1181
10 SASI_Mm02_00304725 predicted 1666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009278 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063723 predicted 1153
2 SASI_Mm01_00063724 predicted 1032
3 SASI_Mm02_00315773 predicted 1705
4 SASI_Mm01_00063726 predicted 1268
5 SASI_Mm01_00063727 predicted 1394
6 SASI_Mm01_00063729 predicted 1393
7 SASI_Mm02_00315774 predicted 1638
8 SASI_Mm01_00063731 predicted 1065
9 SASI_Mm01_00063732 predicted 1213
10 SASI_Mm02_00315775 predicted 1686
11 SASI_Mm01_00063725 predicted 1474
12 SASI_Mm01_00063728 predicted 1388
13 SASI_Mm01_00063730 predicted 1383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009278
VALIDATED
SSB MISSION shRNA Bacterial Glycerol Stock
Sjogren syndrome antigen B (autoantigen La)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009278.4-1405s21c1
Sequence:CCGGCCCGCATCAAAGCATAAGAAACTCGAGTTTCTTATGCTTTGATGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009278.4-795s21c1
Sequence:CCGGGCAGAGCAAAGTGGAAGCTAACTCGAGTTAGCTTCCACTTTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009278.4-316s21c1
Sequence:CCGGGAACAGATCAAATTGGATGAACTCGAGTTCATCCAATTTGATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009278.4-938s21c1
Sequence:CCGGGAGAAGATTTACACTTCCTTTCTCGAGAAAGGAAGTGTAAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009278.4-382s21c1
Sequence:CCGGCGGCTGACAACAGACTTTAATCTCGAGATTAAAGTCTGTTGTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009278.1-1341s1c1
Sequence:CCGGCCCGCATCAAAGCATAAGAAACTCGAGTTTCTTATGCTTTGATGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009278.1-318s1c1
Sequence:CCGGCGGCTGACAACAGACTTTAATCTCGAGATTAAAGTCTGTTGTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009278.1-874s1c1
Sequence:CCGGGAGAAGATTTACACTTCCTTTCTCGAGAAAGGAAGTGTAAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009278.1-252s1c1
Sequence:CCGGGAACAGATCAAATTGGATGAACTCGAGTTCATCCAATTTGATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009278.1-731s1c1
Sequence:CCGGGCAGAGCAAAGTGGAAGCTAACTCGAGTTAGCTTCCACTTTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009278
VALIDATED
SSB MISSION shRNA shRNA Plasmid DNA
Sjogren syndrome antigen B (autoantigen La)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009278.4-1405s21c1
Sequence:CCGGCCCGCATCAAAGCATAAGAAACTCGAGTTTCTTATGCTTTGATGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009278.4-795s21c1
Sequence:CCGGGCAGAGCAAAGTGGAAGCTAACTCGAGTTAGCTTCCACTTTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009278.4-316s21c1
Sequence:CCGGGAACAGATCAAATTGGATGAACTCGAGTTCATCCAATTTGATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009278.4-938s21c1
Sequence:CCGGGAGAAGATTTACACTTCCTTTCTCGAGAAAGGAAGTGTAAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009278.4-382s21c1
Sequence:CCGGCGGCTGACAACAGACTTTAATCTCGAGATTAAAGTCTGTTGTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009278.1-1341s1c1
Sequence:CCGGCCCGCATCAAAGCATAAGAAACTCGAGTTTCTTATGCTTTGATGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009278.1-318s1c1
Sequence:CCGGCGGCTGACAACAGACTTTAATCTCGAGATTAAAGTCTGTTGTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009278.1-874s1c1
Sequence:CCGGGAGAAGATTTACACTTCCTTTCTCGAGAAAGGAAGTGTAAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009278.1-252s1c1
Sequence:CCGGGAACAGATCAAATTGGATGAACTCGAGTTCATCCAATTTGATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009278.1-731s1c1
Sequence:CCGGGCAGAGCAAAGTGGAAGCTAACTCGAGTTAGCTTCCACTTTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009278
VALIDATED
SSB MISSION shRNA Lentiviral Transduction Particles
Sjogren syndrome antigen B (autoantigen La)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009278.4-1405s21c1
Sequence:CCGGCCCGCATCAAAGCATAAGAAACTCGAGTTTCTTATGCTTTGATGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009278.4-795s21c1
Sequence:CCGGGCAGAGCAAAGTGGAAGCTAACTCGAGTTAGCTTCCACTTTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009278.4-316s21c1
Sequence:CCGGGAACAGATCAAATTGGATGAACTCGAGTTCATCCAATTTGATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009278.4-938s21c1
Sequence:CCGGGAGAAGATTTACACTTCCTTTCTCGAGAAAGGAAGTGTAAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009278.4-382s21c1
Sequence:CCGGCGGCTGACAACAGACTTTAATCTCGAGATTAAAGTCTGTTGTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009278.1-1341s1c1
Sequence:CCGGCCCGCATCAAAGCATAAGAAACTCGAGTTTCTTATGCTTTGATGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009278.1-318s1c1
Sequence:CCGGCGGCTGACAACAGACTTTAATCTCGAGATTAAAGTCTGTTGTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009278.1-874s1c1
Sequence:CCGGGAGAAGATTTACACTTCCTTTCTCGAGAAAGGAAGTGTAAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009278.1-252s1c1
Sequence:CCGGGAACAGATCAAATTGGATGAACTCGAGTTCATCCAATTTGATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009278.1-731s1c1
Sequence:CCGGGCAGAGCAAAGTGGAAGCTAACTCGAGTTAGCTTCCACTTTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003142
VALIDATED
SSB MISSION shRNA Bacterial Glycerol Stock
Sjogren syndrome antigen B (autoantigen La)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003142.3-331s21c1
Sequence:CCGGCCAAGGCAGAACTCATGGAAACTCGAGTTTCCATGAGTTCTGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003142.3-197s21c1
Sequence:CCGGGCCACGGGACAAGTTTCTAAACTCGAGTTTAGAAACTTGTCCCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003142.3-1287s21c1
Sequence:CCGGCCTGCATCCAAACAACAGAAACTCGAGTTTCTGTTGTTTGGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003142.3-768s21c1
Sequence:CCGGGCTGAAATGAAATCTCTAGAACTCGAGTTCTAGAGATTTCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003142.2-1070s1c1
Sequence:CCGGCCAACAAGAATCCCTAAACAACTCGAGTTGTTTAGGGATTCTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003142.2-197s1c1
Sequence:CCGGGCCACGGGACAAGTTTCTAAACTCGAGTTTAGAAACTTGTCCCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003142.2-768s1c1
Sequence:CCGGGCTGAAATGAAATCTCTAGAACTCGAGTTCTAGAGATTTCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003142.2-331s1c1
Sequence:CCGGCCAAGGCAGAACTCATGGAAACTCGAGTTTCCATGAGTTCTGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003142.2-1287s1c1
Sequence:CCGGCCTGCATCCAAACAACAGAAACTCGAGTTTCTGTTGTTTGGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003142
VALIDATED
SSB MISSION shRNA shRNA Plasmid DNA
Sjogren syndrome antigen B (autoantigen La)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003142.3-331s21c1
Sequence:CCGGCCAAGGCAGAACTCATGGAAACTCGAGTTTCCATGAGTTCTGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003142.3-197s21c1
Sequence:CCGGGCCACGGGACAAGTTTCTAAACTCGAGTTTAGAAACTTGTCCCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003142.3-1287s21c1
Sequence:CCGGCCTGCATCCAAACAACAGAAACTCGAGTTTCTGTTGTTTGGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003142.3-768s21c1
Sequence:CCGGGCTGAAATGAAATCTCTAGAACTCGAGTTCTAGAGATTTCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003142.2-1070s1c1
Sequence:CCGGCCAACAAGAATCCCTAAACAACTCGAGTTGTTTAGGGATTCTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003142.2-197s1c1
Sequence:CCGGGCCACGGGACAAGTTTCTAAACTCGAGTTTAGAAACTTGTCCCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003142.2-768s1c1
Sequence:CCGGGCTGAAATGAAATCTCTAGAACTCGAGTTCTAGAGATTTCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003142.2-331s1c1
Sequence:CCGGCCAAGGCAGAACTCATGGAAACTCGAGTTTCCATGAGTTCTGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003142.2-1287s1c1
Sequence:CCGGCCTGCATCCAAACAACAGAAACTCGAGTTTCTGTTGTTTGGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003142
VALIDATED
SSB MISSION shRNA Lentiviral Transduction Particles
Sjogren syndrome antigen B (autoantigen La)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003142.3-331s21c1
Sequence:CCGGCCAAGGCAGAACTCATGGAAACTCGAGTTTCCATGAGTTCTGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003142.3-197s21c1
Sequence:CCGGGCCACGGGACAAGTTTCTAAACTCGAGTTTAGAAACTTGTCCCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003142.3-1287s21c1
Sequence:CCGGCCTGCATCCAAACAACAGAAACTCGAGTTTCTGTTGTTTGGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003142.3-768s21c1
Sequence:CCGGGCTGAAATGAAATCTCTAGAACTCGAGTTCTAGAGATTTCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003142.2-1070s1c1
Sequence:CCGGCCAACAAGAATCCCTAAACAACTCGAGTTGTTTAGGGATTCTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003142.2-197s1c1
Sequence:CCGGGCCACGGGACAAGTTTCTAAACTCGAGTTTAGAAACTTGTCCCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003142.2-768s1c1
Sequence:CCGGGCTGAAATGAAATCTCTAGAACTCGAGTTCTAGAGATTTCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003142.2-331s1c1
Sequence:CCGGCCAAGGCAGAACTCATGGAAACTCGAGTTTCCATGAGTTCTGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003142.2-1287s1c1
Sequence:CCGGCCTGCATCCAAACAACAGAAACTCGAGTTTCTGTTGTTTGGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks