EMAIL THIS PAGE TO A FRIEND

SSBP1

single-stranded DNA binding protein 1, mitochondrial

Synonyms: Mt-SSB SOSS-B1 SSBP mtSSB
UniProtKB ID: Q04837
Gene ID:
Human(6742) Summary: SSBP1 is a housekeeping gene involved in mitochondrial biogenesis (Tiranti et al., 1995 [PubMed 7789991]
Mouse(381760) single-stranded DNA binding protein 1
Rat(54304) single-stranded DNA binding protein 1, mitochondrial
cow(515765) single-stranded DNA binding protein 1
sheep(101108908) single-stranded DNA binding protein 1, mitochondrial
naked mole-rat(101707844) single-stranded DNA binding protein 1, mitochondrial
domestic guinea pig(100716942) single-stranded DNA binding protein 1, mitochondrial
Zebrafish(550504) single-stranded DNA binding protein 1
dog(475524) single-stranded DNA binding protein 1
domestic cat(101083159) single-stranded DNA binding protein 1, mitochondrial
chicken(418122) single-stranded DNA binding protein 1, mitochondrial
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_212468 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_212468 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_212468 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003143 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003143 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003143 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003143 Rosetta Predictions human pricing
NM_183328 Rosetta Predictions rat pricing
NM_028358 Rosetta Predictions mouse pricing
NM_212468 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240566 predicted 292
2 SASI_Hs01_00240567 predicted 350
3 SASI_Hs01_00240568 predicted 386
4 SASI_Hs01_00240569 predicted 356
5 SASI_Hs01_00240570 predicted 296
6 SASI_Hs01_00240572 predicted 356
7 SASI_Hs01_00240573 predicted 360
8 SASI_Hs01_00240574 predicted 359
9 SASI_Hs02_00335146 predicted 358
10 SASI_Hs01_00240575 predicted 356
11 SASI_Hs01_00240571 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183328 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055435 predicted 217
2 SASI_Rn01_00055436 predicted 202
3 SASI_Rn01_00055438 predicted 213
4 SASI_Rn01_00055439 predicted 220
5 SASI_Rn01_00055440 predicted 214
6 SASI_Rn01_00055441 predicted 213
7 SASI_Rn01_00055443 predicted 282
8 SASI_Rn02_00269880 predicted 56
9 SASI_Rn02_00269881 predicted 383
10 SASI_Rn02_00269882 predicted 384
11 SASI_Rn01_00055434 predicted 199
12 SASI_Rn01_00055437 predicted 202
13 SASI_Rn01_00055442 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333734 predicted 314
2 SASI_Mm01_00173246 predicted 282
3 SASI_Mm01_00173247 predicted 625
4 SASI_Mm01_00173248 predicted 667
5 SASI_Mm01_00173249 predicted 484
6 SASI_Mm02_00333735 predicted 601
7 SASI_Mm01_00173250 predicted 428
8 SASI_Mm01_00173251 predicted 366
9 SASI_Mm01_00173252 predicted 516
10 SASI_Mm01_00173254 predicted 462
11 SASI_Mm01_00173253 predicted 347
12 SASI_Mm01_00173255 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212468 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023167 predicted 316
2 SASI_Mm01_00023168 predicted 281
3 SASI_Mm01_00023169 predicted 1001
4 SASI_Mm01_00023170 predicted 962
5 SASI_Mm01_00023171 predicted 423
6 SASI_Mm01_00023172 predicted 362
7 SASI_Mm02_00352277 predicted 942
8 SASI_Mm01_00023173 predicted 1014
9 SASI_Mm01_00023175 predicted 340
10 SASI_Mm02_00352278 predicted 939
11 SASI_Mm01_00023174 predicted 374
12 SASI_Mm01_00023176 predicted 940
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_212468
SSBP1 MISSION shRNA Bacterial Glycerol Stock
single-stranded DNA binding protein 1, mitochondrial
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202297    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_212468.3-798s1c1
Sequence:CCGGGCCAAGGCATACATCTGGAAACTCGAGTTTCCAGATGTATGCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212468.3-262s1c1
Sequence:CCGGGCAACAAATGAGATGTGGCGACTCGAGTCGCCACATCTCATTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212468.3-288s21c1
Sequence:CCGGGGATAGTGAAGTATACCAAATCTCGAGATTTGGTATACTTCACTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212468.3-576s21c1
Sequence:CCGGGCAAATCATGTATAGTCTATACTCGAGTATAGACTATACATGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212468.3-530s21c1
Sequence:CCGGAGAACGGATGATTCGTCTTTGCTCGAGCAAAGACGAATCATCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_212468
SSBP1 MISSION shRNA shRNA Plasmid DNA
single-stranded DNA binding protein 1, mitochondrial
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202297    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_212468.3-798s1c1
Sequence:CCGGGCCAAGGCATACATCTGGAAACTCGAGTTTCCAGATGTATGCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212468.3-262s1c1
Sequence:CCGGGCAACAAATGAGATGTGGCGACTCGAGTCGCCACATCTCATTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212468.3-288s21c1
Sequence:CCGGGGATAGTGAAGTATACCAAATCTCGAGATTTGGTATACTTCACTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212468.3-576s21c1
Sequence:CCGGGCAAATCATGTATAGTCTATACTCGAGTATAGACTATACATGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212468.3-530s21c1
Sequence:CCGGAGAACGGATGATTCGTCTTTGCTCGAGCAAAGACGAATCATCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_212468
SSBP1 MISSION shRNA Lentiviral Transduction Particles
single-stranded DNA binding protein 1, mitochondrial
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202297    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_212468.3-798s1c1
Sequence:CCGGGCCAAGGCATACATCTGGAAACTCGAGTTTCCAGATGTATGCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212468.3-262s1c1
Sequence:CCGGGCAACAAATGAGATGTGGCGACTCGAGTCGCCACATCTCATTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212468.3-288s21c1
Sequence:CCGGGGATAGTGAAGTATACCAAATCTCGAGATTTGGTATACTTCACTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212468.3-576s21c1
Sequence:CCGGGCAAATCATGTATAGTCTATACTCGAGTATAGACTATACATGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212468.3-530s21c1
Sequence:CCGGAGAACGGATGATTCGTCTTTGCTCGAGCAAAGACGAATCATCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003143
VALIDATED
SSBP1 MISSION shRNA Bacterial Glycerol Stock
single-stranded DNA binding protein 1, mitochondrial
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003143.1-256s1c1
Sequence:CCGGGCAACTAATGAGATGTGGCGACTCGAGTCGCCACATCTCATTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003143.1-453s1c1
Sequence:CCGGGAGGCGACAAGCAACAACAATCTCGAGATTGTTGTTGCTTGTCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003143.1-289s1c1
Sequence:CCGGGAAGTTTACCAACTGGGTGATCTCGAGATCACCCAGTTGGTAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003143.1-326s1c1
Sequence:CCGGCATGGCACAGAATATCAGTATCTCGAGATACTGATATTCTGTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003143.1-133s1c1
Sequence:CCGGGAAACAACTACCAGTTTGGTTCTCGAGAACCAAACTGGTAGTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003143.1-140s1c1
Sequence:CCGGCTACCAGTTTGGTTCTTGAAACTCGAGTTTCAAGAACCAAACTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_003143.1-106s1c1
Sequence:CCGGCTTCGTCAGTTTGTAAGACATCTCGAGATGTCTTACAAACTGACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003143.1-143s1c1
Sequence:CCGGCCAGTTTGGTTCTTGAAAGATCTCGAGATCTTTCAAGAACCAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003143.1-361s21c1
Sequence:CCGGAGAGACGTGGCATATCAATATCTCGAGATATTGATATGCCACGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003143.1-453s21c1
Sequence:CCGGGAGGCGACAAGCAACAACAATCTCGAGATTGTTGTTGCTTGTCGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003143.1-326s21c1
Sequence:CCGGCATGGCACAGAATATCAGTATCTCGAGATACTGATATTCTGTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003143.1-143s21c1
Sequence:CCGGCCAGTTTGGTTCTTGAAAGATCTCGAGATCTTTCAAGAACCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003143
VALIDATED
SSBP1 MISSION shRNA shRNA Plasmid DNA
single-stranded DNA binding protein 1, mitochondrial
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003143.1-256s1c1
Sequence:CCGGGCAACTAATGAGATGTGGCGACTCGAGTCGCCACATCTCATTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003143.1-453s1c1
Sequence:CCGGGAGGCGACAAGCAACAACAATCTCGAGATTGTTGTTGCTTGTCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003143.1-289s1c1
Sequence:CCGGGAAGTTTACCAACTGGGTGATCTCGAGATCACCCAGTTGGTAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003143.1-326s1c1
Sequence:CCGGCATGGCACAGAATATCAGTATCTCGAGATACTGATATTCTGTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003143.1-133s1c1
Sequence:CCGGGAAACAACTACCAGTTTGGTTCTCGAGAACCAAACTGGTAGTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003143.1-140s1c1
Sequence:CCGGCTACCAGTTTGGTTCTTGAAACTCGAGTTTCAAGAACCAAACTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_003143.1-106s1c1
Sequence:CCGGCTTCGTCAGTTTGTAAGACATCTCGAGATGTCTTACAAACTGACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003143.1-143s1c1
Sequence:CCGGCCAGTTTGGTTCTTGAAAGATCTCGAGATCTTTCAAGAACCAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003143.1-361s21c1
Sequence:CCGGAGAGACGTGGCATATCAATATCTCGAGATATTGATATGCCACGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003143.1-453s21c1
Sequence:CCGGGAGGCGACAAGCAACAACAATCTCGAGATTGTTGTTGCTTGTCGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003143.1-326s21c1
Sequence:CCGGCATGGCACAGAATATCAGTATCTCGAGATACTGATATTCTGTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003143.1-143s21c1
Sequence:CCGGCCAGTTTGGTTCTTGAAAGATCTCGAGATCTTTCAAGAACCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003143
VALIDATED
SSBP1 MISSION shRNA Lentiviral Transduction Particles
single-stranded DNA binding protein 1, mitochondrial
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003143.1-256s1c1
Sequence:CCGGGCAACTAATGAGATGTGGCGACTCGAGTCGCCACATCTCATTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003143.1-453s1c1
Sequence:CCGGGAGGCGACAAGCAACAACAATCTCGAGATTGTTGTTGCTTGTCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003143.1-289s1c1
Sequence:CCGGGAAGTTTACCAACTGGGTGATCTCGAGATCACCCAGTTGGTAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003143.1-326s1c1
Sequence:CCGGCATGGCACAGAATATCAGTATCTCGAGATACTGATATTCTGTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003143.1-133s1c1
Sequence:CCGGGAAACAACTACCAGTTTGGTTCTCGAGAACCAAACTGGTAGTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003143.1-140s1c1
Sequence:CCGGCTACCAGTTTGGTTCTTGAAACTCGAGTTTCAAGAACCAAACTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_003143.1-106s1c1
Sequence:CCGGCTTCGTCAGTTTGTAAGACATCTCGAGATGTCTTACAAACTGACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003143.1-143s1c1
Sequence:CCGGCCAGTTTGGTTCTTGAAAGATCTCGAGATCTTTCAAGAACCAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003143.1-361s21c1
Sequence:CCGGAGAGACGTGGCATATCAATATCTCGAGATATTGATATGCCACGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003143.1-453s21c1
Sequence:CCGGGAGGCGACAAGCAACAACAATCTCGAGATTGTTGTTGCTTGTCGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003143.1-326s21c1
Sequence:CCGGCATGGCACAGAATATCAGTATCTCGAGATACTGATATTCTGTGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003143.1-143s21c1
Sequence:CCGGCCAGTTTGGTTCTTGAAAGATCTCGAGATCTTTCAAGAACCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks