EMAIL THIS PAGE TO A FRIEND

SSBP2

single-stranded DNA binding protein 2

Synonyms: HSPC116 SOSS-B2
Gene ID:
Human(23635) Summary: SSBP2 is a subunit of a single-stranded DNA (ssDNA)-binding complex involved in the maintenance of genome stability (Huang et al., 2009) [PubMed 19683501]
Mouse(66970) single-stranded DNA binding protein 2
Rat(361877) single-stranded DNA binding protein 2
chicken(770958) single-stranded DNA binding protein 2
dog(479160) single-stranded DNA binding protein 2
domestic cat(101088719) single-stranded DNA binding protein 2
domestic guinea pig(100729506) single-stranded DNA binding protein 2
naked mole-rat(101705238) single-stranded DNA binding protein 2
cow(616564) single-stranded DNA binding protein 2
sheep(101118446) single-stranded DNA binding protein 2
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012446 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024272 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024272 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024272 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012446 Rosetta Predictions human pricing
XM_001065491 Rosetta Predictions rat pricing
XM_342171 Rosetta Predictions rat pricing
NM_024186 Rosetta Predictions mouse pricing
NM_024272 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052778 predicted 1375
2 SASI_Hs01_00052779 predicted 1158
3 SASI_Hs01_00052780 predicted 1170
4 SASI_Hs01_00052781 predicted 987
5 SASI_Hs01_00052782 predicted 1233
6 SASI_Hs01_00052784 predicted 731
7 SASI_Hs01_00052785 predicted 261
8 SASI_Hs01_00052786 predicted 450
9 SASI_Hs01_00052787 predicted 1277
10 SASI_Hs02_00344347 predicted 1343
11 SASI_Hs01_00052783 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065491 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314340 predicted 1046
2 SASI_Rn02_00314341 predicted 1049
3 SASI_Rn02_00314342 predicted 194
4 SASI_Rn02_00314343 predicted 758
5 SASI_Rn02_00314344 predicted 887
6 SASI_Rn02_00314345 predicted 1275
7 SASI_Rn02_00314346 predicted 593
8 SASI_Rn02_00314347 predicted 578
9 SASI_Rn02_00314348 predicted 1136
10 SASI_Rn02_00314349 predicted 1165
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342171 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393853 predicted 1045
2 SASI_Rn02_00393854 predicted 1055
3 SASI_Rn02_00393855 predicted 193
4 SASI_Rn02_00393856 predicted 756
5 SASI_Rn02_00393857 predicted 884
6 SASI_Rn02_00393858 predicted 1278
7 SASI_Rn02_00393859 predicted 595
8 SASI_Rn02_00393860 predicted 579
9 SASI_Rn02_00393861 predicted 1131
10 SASI_Rn02_00393862 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024186 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327509 predicted 1185
2 SASI_Mm02_00327510 predicted 954
3 SASI_Mm02_00327511 predicted 900
4 SASI_Mm01_00186869 predicted 620
5 SASI_Mm01_00186870 predicted 794
6 SASI_Mm02_00327512 predicted 946
7 SASI_Mm02_00327513 predicted 804
8 SASI_Mm02_00327514 predicted 1351
9 SASI_Mm02_00327515 predicted 1340
10 SASI_Mm02_00327516 predicted 790
11 SASI_Mm01_00186865 predicted 1410
12 SASI_Mm01_00186866 predicted 629
13 SASI_Mm01_00186867 predicted 1394
14 SASI_Mm01_00186868 predicted 672
15 SASI_Mm01_00186871 predicted 843
16 SASI_Mm01_00186872 predicted 807
17 SASI_Mm01_00186873 predicted 675
18 SASI_Mm01_00186874 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024272 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327675 predicted 1232
2 SASI_Mm02_00327676 predicted 994
3 SASI_Mm02_00327677 predicted 1000
4 SASI_Mm02_00327678 predicted 713
5 SASI_Mm02_00327679 predicted 936
6 SASI_Mm02_00327680 predicted 653
7 SASI_Mm01_00069676 predicted 835
8 SASI_Mm02_00327681 predicted 985
9 SASI_Mm02_00327682 predicted 1389
10 SASI_Mm02_00327683 predicted 1373
11 SASI_Mm01_00069672 predicted 1447
12 SASI_Mm01_00069673 predicted 666
13 SASI_Mm01_00069674 predicted 1432
14 SASI_Mm01_00069675 predicted 706
15 SASI_Mm01_00069677 predicted 883
16 SASI_Mm01_00069678 predicted 755
17 SASI_Mm01_00069679 predicted 869
18 SASI_Mm01_00069680 predicted 833
19 SASI_Mm01_00069681 predicted 843
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012446
VALIDATED
SSBP2 MISSION shRNA Bacterial Glycerol Stock
single-stranded DNA binding protein 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012446.2-1284s21c1
Sequence:CCGGCAATGAGCGTGTGATCCATTACTCGAGTAATGGATCACACGCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012446.2-1483s21c1
Sequence:CCGGACTGTACGGAGTGGCATATTACTCGAGTAATATGCCACTCCGTACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012446.2-1210s21c1
Sequence:CCGGTCCAAGGGATGATGGCGAAATCTCGAGATTTCGCCATCATCCCTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_012446.2-880s1c1
Sequence:CCGGCCCAACAAATGCCAATTCAATCTCGAGATTGAATTGGCATTTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_012446.2-1164s1c1
Sequence:CCGGCCAAGAATTCTCCCAATAATACTCGAGTATTATTGGGAGAATTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_012446.2-1118s1c1
Sequence:CCGGCATCACATGAATGGCTCTTTACTCGAGTAAAGAGCCATTCATGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_012446.2-435s1c1
Sequence:CCGGCTCCAGAGAGACGTGAAACATCTCGAGATGTTTCACGTCTCTCTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_012446.2-695s1c1
Sequence:CCGGCCAACTCGACAACAAGGACATCTCGAGATGTCCTTGTTGTCGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012446
VALIDATED
SSBP2 MISSION shRNA shRNA Plasmid DNA
single-stranded DNA binding protein 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012446.2-1284s21c1
Sequence:CCGGCAATGAGCGTGTGATCCATTACTCGAGTAATGGATCACACGCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012446.2-1483s21c1
Sequence:CCGGACTGTACGGAGTGGCATATTACTCGAGTAATATGCCACTCCGTACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012446.2-1210s21c1
Sequence:CCGGTCCAAGGGATGATGGCGAAATCTCGAGATTTCGCCATCATCCCTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_012446.2-880s1c1
Sequence:CCGGCCCAACAAATGCCAATTCAATCTCGAGATTGAATTGGCATTTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_012446.2-1164s1c1
Sequence:CCGGCCAAGAATTCTCCCAATAATACTCGAGTATTATTGGGAGAATTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_012446.2-1118s1c1
Sequence:CCGGCATCACATGAATGGCTCTTTACTCGAGTAAAGAGCCATTCATGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_012446.2-435s1c1
Sequence:CCGGCTCCAGAGAGACGTGAAACATCTCGAGATGTTTCACGTCTCTCTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_012446.2-695s1c1
Sequence:CCGGCCAACTCGACAACAAGGACATCTCGAGATGTCCTTGTTGTCGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012446
VALIDATED
SSBP2 MISSION shRNA Lentiviral Transduction Particles
single-stranded DNA binding protein 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012446.2-1284s21c1
Sequence:CCGGCAATGAGCGTGTGATCCATTACTCGAGTAATGGATCACACGCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012446.2-1483s21c1
Sequence:CCGGACTGTACGGAGTGGCATATTACTCGAGTAATATGCCACTCCGTACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012446.2-1210s21c1
Sequence:CCGGTCCAAGGGATGATGGCGAAATCTCGAGATTTCGCCATCATCCCTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_012446.2-880s1c1
Sequence:CCGGCCCAACAAATGCCAATTCAATCTCGAGATTGAATTGGCATTTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_012446.2-1164s1c1
Sequence:CCGGCCAAGAATTCTCCCAATAATACTCGAGTATTATTGGGAGAATTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_012446.2-1118s1c1
Sequence:CCGGCATCACATGAATGGCTCTTTACTCGAGTAAAGAGCCATTCATGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_012446.2-435s1c1
Sequence:CCGGCTCCAGAGAGACGTGAAACATCTCGAGATGTTTCACGTCTCTCTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_012446.2-695s1c1
Sequence:CCGGCCAACTCGACAACAAGGACATCTCGAGATGTCCTTGTTGTCGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024272
VALIDATED
SSBP2 MISSION shRNA Bacterial Glycerol Stock
single-stranded DNA binding protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024272.3-952s21c1
Sequence:CCGGCCATCACATGAACGGCTCTTTCTCGAGAAAGAGCCGTTCATGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024272.3-530s21c1
Sequence:CCGGCCAACACGACAACAAGGACATCTCGAGATGTCCTTGTTGTCGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024272.3-108s21c1
Sequence:CCGGAGTTAGCACTCTACGTGTATGCTCGAGCATACACGTAGAGTGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024272.3-746s21c1
Sequence:CCGGTCAGCGTCTCCTGGGAATTACCTCGAGGTAATTCCCAGGAGACGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024272.3-1378s21c1
Sequence:CCGGGGAAGAGAATGCATCGTATATCTCGAGATATACGATGCATTCTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024272.2-1352s1c1
Sequence:CCGGGCGATGATTATCTGTGTGTATCTCGAGATACACACAGATAATCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024272.2-952s1c1
Sequence:CCGGCCATCACATGAACGGCTCTTTCTCGAGAAAGAGCCGTTCATGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024272.2-150s1c1
Sequence:CCGGCTCAGAAATCGGCTCAGACATCTCGAGATGTCTGAGCCGATTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024272.2-530s1c1
Sequence:CCGGCCAACACGACAACAAGGACATCTCGAGATGTCCTTGTTGTCGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024272.2-715s1c1
Sequence:CCGGCCCAACAAATGCGAATTCAATCTCGAGATTGAATTCGCATTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024272
VALIDATED
SSBP2 MISSION shRNA shRNA Plasmid DNA
single-stranded DNA binding protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024272.3-952s21c1
Sequence:CCGGCCATCACATGAACGGCTCTTTCTCGAGAAAGAGCCGTTCATGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024272.3-530s21c1
Sequence:CCGGCCAACACGACAACAAGGACATCTCGAGATGTCCTTGTTGTCGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024272.3-108s21c1
Sequence:CCGGAGTTAGCACTCTACGTGTATGCTCGAGCATACACGTAGAGTGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024272.3-746s21c1
Sequence:CCGGTCAGCGTCTCCTGGGAATTACCTCGAGGTAATTCCCAGGAGACGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024272.3-1378s21c1
Sequence:CCGGGGAAGAGAATGCATCGTATATCTCGAGATATACGATGCATTCTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024272.2-1352s1c1
Sequence:CCGGGCGATGATTATCTGTGTGTATCTCGAGATACACACAGATAATCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024272.2-952s1c1
Sequence:CCGGCCATCACATGAACGGCTCTTTCTCGAGAAAGAGCCGTTCATGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024272.2-150s1c1
Sequence:CCGGCTCAGAAATCGGCTCAGACATCTCGAGATGTCTGAGCCGATTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024272.2-530s1c1
Sequence:CCGGCCAACACGACAACAAGGACATCTCGAGATGTCCTTGTTGTCGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024272.2-715s1c1
Sequence:CCGGCCCAACAAATGCGAATTCAATCTCGAGATTGAATTCGCATTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024272
VALIDATED
SSBP2 MISSION shRNA Lentiviral Transduction Particles
single-stranded DNA binding protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024272.3-952s21c1
Sequence:CCGGCCATCACATGAACGGCTCTTTCTCGAGAAAGAGCCGTTCATGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024272.3-530s21c1
Sequence:CCGGCCAACACGACAACAAGGACATCTCGAGATGTCCTTGTTGTCGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024272.3-108s21c1
Sequence:CCGGAGTTAGCACTCTACGTGTATGCTCGAGCATACACGTAGAGTGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024272.3-746s21c1
Sequence:CCGGTCAGCGTCTCCTGGGAATTACCTCGAGGTAATTCCCAGGAGACGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024272.3-1378s21c1
Sequence:CCGGGGAAGAGAATGCATCGTATATCTCGAGATATACGATGCATTCTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024272.2-1352s1c1
Sequence:CCGGGCGATGATTATCTGTGTGTATCTCGAGATACACACAGATAATCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024272.2-952s1c1
Sequence:CCGGCCATCACATGAACGGCTCTTTCTCGAGAAAGAGCCGTTCATGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024272.2-150s1c1
Sequence:CCGGCTCAGAAATCGGCTCAGACATCTCGAGATGTCTGAGCCGATTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024272.2-530s1c1
Sequence:CCGGCCAACACGACAACAAGGACATCTCGAGATGTCCTTGTTGTCGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024272.2-715s1c1
Sequence:CCGGCCCAACAAATGCGAATTCAATCTCGAGATTGAATTCGCATTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks