EMAIL THIS PAGE TO A FRIEND

SSBP3-AS1

SSBP3 antisense RNA 1

Synonyms: C1orf191 MST128
Species: Human SSBP3-AS1(619518)
Gene ID:
41 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001034847 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001034847 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001034847 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034847 Rosetta Predictions human pricing
XR_040117 Rosetta Predictions human pricing
XR_040118 Rosetta Predictions human pricing
XR_040119 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225955 predicted 286
2 SASI_Hs01_00225956 predicted 263
3 SASI_Hs01_00225957 predicted 605
4 SASI_Hs01_00225958 predicted 586
5 SASI_Hs01_00225959 predicted 351
6 SASI_Hs01_00225960 predicted 291
7 SASI_Hs01_00225961 predicted 396
8 SASI_Hs01_00225962 predicted 587
9 SASI_Hs01_00225963 predicted 616
10 SASI_Hs01_00225964 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516029 predicted 1283
2 SASI_Hs02_00516030 predicted 521
3 SASI_Hs02_00516031 predicted 1223
4 SASI_Hs02_00516032 predicted 1649
5 SASI_Hs02_00516033 predicted 1985
6 SASI_Hs02_00516034 predicted 557
7 SASI_Hs02_00516035 predicted 501
8 SASI_Hs02_00516036 predicted 453
9 SASI_Hs02_00516037 predicted 605
10 SASI_Hs02_00516038 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516039 predicted 1274
2 SASI_Hs02_00516040 predicted 524
3 SASI_Hs02_00516041 predicted 1227
4 SASI_Hs02_00516042 predicted 1654
5 SASI_Hs02_00516043 predicted 1985
6 SASI_Hs02_00516044 predicted 564
7 SASI_Hs02_00516045 predicted 500
8 SASI_Hs02_00516046 predicted 447
9 SASI_Hs02_00516047 predicted 605
10 SASI_Hs02_00516048 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040119 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516049 predicted 1281
2 SASI_Hs02_00516050 predicted 525
3 SASI_Hs02_00516051 predicted 1230
4 SASI_Hs02_00516052 predicted 1653
5 SASI_Hs02_00516053 predicted 1985
6 SASI_Hs02_00516054 predicted 557
7 SASI_Hs02_00516055 predicted 504
8 SASI_Hs02_00516056 predicted 447
9 SASI_Hs02_00516057 predicted 604
10 SASI_Hs02_00516058 predicted 456
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034847
SSBP3-AS1 MISSION shRNA Bacterial Glycerol Stock
SSBP3 antisense RNA 1
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000180750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001034847.1-602s1c1
Sequence:CCGGGCAAAGAAGCTGCCAGGTATTCTCGAGAATACCTGGCAGCTTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034847.1-123s1c1
Sequence:CCGGGCTGCTGGATGTAGGCAATATCTCGAGATATTGCCTACATCCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034847
SSBP3-AS1 MISSION shRNA shRNA Plasmid DNA
SSBP3 antisense RNA 1
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000180750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001034847.1-602s1c1
Sequence:CCGGGCAAAGAAGCTGCCAGGTATTCTCGAGAATACCTGGCAGCTTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034847.1-123s1c1
Sequence:CCGGGCTGCTGGATGTAGGCAATATCTCGAGATATTGCCTACATCCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034847
SSBP3-AS1 MISSION shRNA Lentiviral Transduction Particles
SSBP3 antisense RNA 1
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000180750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001034847.1-602s1c1
Sequence:CCGGGCAAAGAAGCTGCCAGGTATTCTCGAGAATACCTGGCAGCTTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034847.1-123s1c1
Sequence:CCGGGCTGCTGGATGTAGGCAATATCTCGAGATATTGCCTACATCCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks