EMAIL THIS PAGE TO A FRIEND

SSBP3

single stranded DNA binding protein 3

Synonyms: CSDP SSDP SSDP1
UniProtKB ID: Q9BWW4, A8K0A9, Q5T860, Q5T861, Q9BTM0, Q9BWW3
Gene ID:
Mouse(72475) single-stranded DNA binding protein 3
Rat(84354) single stranded DNA binding protein 3
cow(530184) single stranded DNA binding protein 3
sheep(101117983) single stranded DNA binding protein 3
naked mole-rat(101699018) single stranded DNA binding protein 3
domestic guinea pig(100734323) single stranded DNA binding protein 3
chicken(395250) single stranded DNA binding protein 3
domestic cat(101097260) single stranded DNA binding protein 3
dog(610575) single stranded DNA binding protein 3
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102306 Anti-SSBP3 (ab1) antibody produced in rabbit affinity isolated antibody bovine, guinea pig, horse, human, mouse, rabbit, zebrafish, rat
western blot pricing
SAB2102307 Anti-SSBP3 (ab2) antibody produced in rabbit affinity isolated antibody , canine, mouse, guinea pig, rabbit, bovine, horse, zebrafish, human, rat
western blot pricing
WH0023648M1 Monoclonal Anti-SSBP3 antibody produced in mouse clone 3E6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018070 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018070 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018070 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023672 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023672 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023672 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009955 Rosetta Predictions human pricing
NM_018070 Rosetta Predictions human pricing
NM_145716 Rosetta Predictions human pricing
NM_053358 Rosetta Predictions rat pricing
NM_023672 Rosetta Predictions mouse pricing
NM_198438 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057553 predicted 1065
2 SASI_Hs01_00057555 predicted 1202
3 SASI_Hs01_00057557 predicted 1367
4 SASI_Hs01_00057559 predicted 1313
5 SASI_Hs01_00057560 predicted 1073
6 SASI_Hs02_00305744 predicted 1081
7 SASI_Hs01_00057562 predicted 1068
8 SASI_Hs02_00305745 predicted 1105
9 SASI_Hs02_00305746 predicted 1303
10 SASI_Hs02_00305747 predicted 1371
11 SASI_Hs01_00057554 predicted 1452
12 SASI_Hs01_00057556 predicted 1410
13 SASI_Hs01_00057558 predicted 1320
14 SASI_Hs01_00057561 predicted 1333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233826 predicted 979
2 SASI_Hs01_00233827 predicted 1106
3 SASI_Hs01_00233828 predicted 1274
4 SASI_Hs01_00233829 predicted 1220
5 SASI_Hs01_00233830 predicted 983
6 SASI_Hs01_00233831 predicted 990
7 SASI_Hs01_00233832 predicted 976
8 SASI_Hs01_00233833 predicted 1017
9 SASI_Hs01_00233834 predicted 1211
10 SASI_Hs01_00233835 predicted 1270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195033 predicted 1036
2 SASI_Hs01_00195034 predicted 1169
3 SASI_Hs01_00195035 predicted 1334
4 SASI_Hs01_00195036 predicted 1280
5 SASI_Hs01_00195037 predicted 1041
6 SASI_Hs01_00195038 predicted 1051
7 SASI_Hs01_00195039 predicted 1037
8 SASI_Hs01_00195040 predicted 1073
9 SASI_Hs01_00195041 predicted 1266
10 SASI_Hs01_00195042 predicted 1334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053358 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060521 predicted 1134
2 SASI_Rn01_00060523 predicted 1250
3 SASI_Rn01_00060524 predicted 1371
4 SASI_Rn01_00060525 predicted 1304
5 SASI_Rn01_00060526 predicted 1110
6 SASI_Rn01_00060527 predicted 1099
7 SASI_Rn01_00060528 predicted 1412
8 SASI_Rn01_00060529 predicted 1296
9 SASI_Rn01_00060530 predicted 1100
10 SASI_Rn02_00265826 predicted 1117
11 SASI_Rn01_00060522 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054298 predicted 1590
2 SASI_Mm01_00054299 predicted 1251
3 SASI_Mm01_00054300 predicted 1248
4 SASI_Mm01_00054301 predicted 1121
5 SASI_Mm02_00327292 predicted 1427
6 SASI_Mm01_00054303 predicted 1499
7 SASI_Mm01_00054304 predicted 1382
8 SASI_Mm01_00054305 predicted 1141
9 SASI_Mm01_00054306 predicted 1129
10 SASI_Mm01_00054307 predicted 1145
11 SASI_Mm01_00054302 predicted 1399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350992 predicted 1425
2 SASI_Mm01_00136622 predicted 1507
3 SASI_Mm01_00136623 predicted 1177
4 SASI_Mm01_00136624 predicted 1164
5 SASI_Mm02_00350993 predicted 890
6 SASI_Mm01_00136626 predicted 1314
7 SASI_Mm02_00350994 predicted 1345
8 SASI_Mm01_00136627 predicted 1421
9 SASI_Mm02_00350995 predicted 648
10 SASI_Mm02_00350996 predicted 1505
11 SASI_Mm01_00136625 predicted 1053
12 SASI_Mm01_00136628 predicted 1309
13 SASI_Mm01_00136629 predicted 1057
14 SASI_Mm01_00136630 predicted 1057
15 SASI_Mm01_00136631 predicted 1070
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018070
VALIDATED
SSBP3 MISSION shRNA Bacterial Glycerol Stock
single stranded DNA binding protein 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_018070.2-1029s1c1
Sequence:CCGGGACAACATCTACACAATGATTCTCGAGAATCATTGTGTAGATGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018070.2-1286s1c1
Sequence:CCGGCGACAATTATTCTCCAAGCATCTCGAGATGCTTGGAGAATAATTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018070.2-977s1c1
Sequence:CCGGTCCTCCAGGAACACCCATTATCTCGAGATAATGGGTGTTCCTGGAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018070.2-1197s1c1
Sequence:CCGGCCTAACAACATAAGTGGCATTCTCGAGAATGCCACTTATGTTGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018070.2-276s1c1
Sequence:CCGGGCTTTATACGTCTACGAATATCTCGAGATATTCGTAGACGTATAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018070.3-382s21c1
Sequence:CCGGACTGCACGTAGGAGCACAGAACTCGAGTTCTGTGCTCCTACGTGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018070.3-1481s21c1
Sequence:CCGGTGTCATTATCCAGGAGCTGGTCTCGAGACCAGCTCCTGGATAATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018070.3-393s21c1
Sequence:CCGGGAGCACAGAAATCTGCACAGACTCGAGTCTGTGCAGATTTCTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018070.3-1642s21c1
Sequence:CCGGTTTCAAGTCAGTGACCAGAAACTCGAGTTTCTGGTCACTGACTTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018070.3-518s21c1
Sequence:CCGGCCTGAAAGGAGAGACACTTGTCTCGAGACAAGTGTCTCTCCTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018070
VALIDATED
SSBP3 MISSION shRNA shRNA Plasmid DNA
single stranded DNA binding protein 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_018070.2-1029s1c1
Sequence:CCGGGACAACATCTACACAATGATTCTCGAGAATCATTGTGTAGATGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018070.2-1286s1c1
Sequence:CCGGCGACAATTATTCTCCAAGCATCTCGAGATGCTTGGAGAATAATTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018070.2-977s1c1
Sequence:CCGGTCCTCCAGGAACACCCATTATCTCGAGATAATGGGTGTTCCTGGAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018070.2-1197s1c1
Sequence:CCGGCCTAACAACATAAGTGGCATTCTCGAGAATGCCACTTATGTTGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018070.2-276s1c1
Sequence:CCGGGCTTTATACGTCTACGAATATCTCGAGATATTCGTAGACGTATAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018070.3-382s21c1
Sequence:CCGGACTGCACGTAGGAGCACAGAACTCGAGTTCTGTGCTCCTACGTGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018070.3-1481s21c1
Sequence:CCGGTGTCATTATCCAGGAGCTGGTCTCGAGACCAGCTCCTGGATAATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018070.3-393s21c1
Sequence:CCGGGAGCACAGAAATCTGCACAGACTCGAGTCTGTGCAGATTTCTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018070.3-1642s21c1
Sequence:CCGGTTTCAAGTCAGTGACCAGAAACTCGAGTTTCTGGTCACTGACTTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018070.3-518s21c1
Sequence:CCGGCCTGAAAGGAGAGACACTTGTCTCGAGACAAGTGTCTCTCCTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018070
VALIDATED
SSBP3 MISSION shRNA Lentiviral Transduction Particles
single stranded DNA binding protein 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_018070.2-1029s1c1
Sequence:CCGGGACAACATCTACACAATGATTCTCGAGAATCATTGTGTAGATGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018070.2-1286s1c1
Sequence:CCGGCGACAATTATTCTCCAAGCATCTCGAGATGCTTGGAGAATAATTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018070.2-977s1c1
Sequence:CCGGTCCTCCAGGAACACCCATTATCTCGAGATAATGGGTGTTCCTGGAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018070.2-1197s1c1
Sequence:CCGGCCTAACAACATAAGTGGCATTCTCGAGAATGCCACTTATGTTGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018070.2-276s1c1
Sequence:CCGGGCTTTATACGTCTACGAATATCTCGAGATATTCGTAGACGTATAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018070.3-382s21c1
Sequence:CCGGACTGCACGTAGGAGCACAGAACTCGAGTTCTGTGCTCCTACGTGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018070.3-1481s21c1
Sequence:CCGGTGTCATTATCCAGGAGCTGGTCTCGAGACCAGCTCCTGGATAATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018070.3-393s21c1
Sequence:CCGGGAGCACAGAAATCTGCACAGACTCGAGTCTGTGCAGATTTCTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018070.3-1642s21c1
Sequence:CCGGTTTCAAGTCAGTGACCAGAAACTCGAGTTTCTGGTCACTGACTTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018070.3-518s21c1
Sequence:CCGGCCTGAAAGGAGAGACACTTGTCTCGAGACAAGTGTCTCTCCTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023672
VALIDATED
SSBP3 MISSION shRNA Bacterial Glycerol Stock
single stranded DNA binding protein 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023672.2-2759s1c1
Sequence:CCGGGCAACCAAACAGACACTGTTTCTCGAGAAACAGTGTCTGTTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023672.2-447s1c1
Sequence:CCGGAGCTTTATACGTCTACGAATACTCGAGTATTCGTAGACGTATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023672.2-1518s1c1
Sequence:CCGGCGACAATTATTCTCCGAGCATCTCGAGATGCTCGGAGAATAATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023672.2-1506s1c1
Sequence:CCGGCTCCTTCCAGAACGACAATTACTCGAGTAATTGTCGTTCTGGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023672.2-503s1c1
Sequence:CCGGCCTTCTTATCAGAGATTCGATCTCGAGATCGAATCTCTGATAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023672.2-447s21c1
Sequence:CCGGAGCTTTATACGTCTACGAATACTCGAGTATTCGTAGACGTATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023672.2-503s21c1
Sequence:CCGGCCTTCTTATCAGAGATTCGATCTCGAGATCGAATCTCTGATAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023672.2-1589s21c1
Sequence:CCGGCAGAAGATGCCAAGAATTATGCTCGAGCATAATTCTTGGCATCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023672.2-1518s21c1
Sequence:CCGGCGACAATTATTCTCCGAGCATCTCGAGATGCTCGGAGAATAATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023672.2-1506s21c1
Sequence:CCGGCTCCTTCCAGAACGACAATTACTCGAGTAATTGTCGTTCTGGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023672
VALIDATED
SSBP3 MISSION shRNA shRNA Plasmid DNA
single stranded DNA binding protein 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023672.2-2759s1c1
Sequence:CCGGGCAACCAAACAGACACTGTTTCTCGAGAAACAGTGTCTGTTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023672.2-447s1c1
Sequence:CCGGAGCTTTATACGTCTACGAATACTCGAGTATTCGTAGACGTATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023672.2-1518s1c1
Sequence:CCGGCGACAATTATTCTCCGAGCATCTCGAGATGCTCGGAGAATAATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023672.2-1506s1c1
Sequence:CCGGCTCCTTCCAGAACGACAATTACTCGAGTAATTGTCGTTCTGGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023672.2-503s1c1
Sequence:CCGGCCTTCTTATCAGAGATTCGATCTCGAGATCGAATCTCTGATAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023672.2-447s21c1
Sequence:CCGGAGCTTTATACGTCTACGAATACTCGAGTATTCGTAGACGTATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023672.2-503s21c1
Sequence:CCGGCCTTCTTATCAGAGATTCGATCTCGAGATCGAATCTCTGATAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023672.2-1589s21c1
Sequence:CCGGCAGAAGATGCCAAGAATTATGCTCGAGCATAATTCTTGGCATCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023672.2-1518s21c1
Sequence:CCGGCGACAATTATTCTCCGAGCATCTCGAGATGCTCGGAGAATAATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023672.2-1506s21c1
Sequence:CCGGCTCCTTCCAGAACGACAATTACTCGAGTAATTGTCGTTCTGGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023672
VALIDATED
SSBP3 MISSION shRNA Lentiviral Transduction Particles
single stranded DNA binding protein 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023672.2-2759s1c1
Sequence:CCGGGCAACCAAACAGACACTGTTTCTCGAGAAACAGTGTCTGTTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023672.2-447s1c1
Sequence:CCGGAGCTTTATACGTCTACGAATACTCGAGTATTCGTAGACGTATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023672.2-1518s1c1
Sequence:CCGGCGACAATTATTCTCCGAGCATCTCGAGATGCTCGGAGAATAATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023672.2-1506s1c1
Sequence:CCGGCTCCTTCCAGAACGACAATTACTCGAGTAATTGTCGTTCTGGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023672.2-503s1c1
Sequence:CCGGCCTTCTTATCAGAGATTCGATCTCGAGATCGAATCTCTGATAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023672.2-447s21c1
Sequence:CCGGAGCTTTATACGTCTACGAATACTCGAGTATTCGTAGACGTATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023672.2-503s21c1
Sequence:CCGGCCTTCTTATCAGAGATTCGATCTCGAGATCGAATCTCTGATAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023672.2-1589s21c1
Sequence:CCGGCAGAAGATGCCAAGAATTATGCTCGAGCATAATTCTTGGCATCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023672.2-1518s21c1
Sequence:CCGGCGACAATTATTCTCCGAGCATCTCGAGATGCTCGGAGAATAATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023672.2-1506s21c1
Sequence:CCGGCTCCTTCCAGAACGACAATTACTCGAGTAATTGTCGTTCTGGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks