EMAIL THIS PAGE TO A FRIEND

SSBP4

single stranded DNA binding protein 4

UniProtKB ID: Q9BWG4
Gene ID:
Mouse(76900) single stranded DNA binding protein 4
Rat(364534) single stranded DNA binding protein 4
Zebrafish(321750) single stranded DNA binding protein 4
dog(484821) single stranded DNA binding protein 4
domestic cat(101095085) single stranded DNA binding protein 4
domestic guinea pig(100735164) single stranded DNA binding protein 4
naked mole-rat(101724919) single stranded DNA binding protein 4
cow(508156) single stranded DNA binding protein 4
sheep(101109967) single stranded DNA binding protein 4
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301648 Anti-SSBP4 affinity isolated antibody human
immunohistochemistry pricing
AV39711 Anti-SSBP4 (AB1) antibody produced in rabbit affinity isolated antibody , human, zebrafish, mouse, bovine, canine, rat, guinea pig, rabbit
western blot pricing
AV39712 Anti-SSBP4 (AB2) antibody produced in rabbit affinity isolated antibody , rat, human, horse, bovine, zebrafish, mouse, canine, guinea pig, rabbit
western blot pricing
SAB1408420 Anti-SSBP4 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2103502 Anti-SSBP4 antibody produced in rabbit affinity isolated antibody canine, bovine, human, rat, guinea pig, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032627 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032627 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032627 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133772 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133772 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133772 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078961 MISSION® esiRNA esiRNA human SSBP4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009998 Rosetta Predictions human pricing
NM_032627 Rosetta Predictions human pricing
NM_001014236 Rosetta Predictions rat pricing
NM_133772 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055842 predicted 384
2 SASI_Hs01_00055843 predicted 366
3 SASI_Hs01_00055844 predicted 1544
4 SASI_Hs01_00055846 predicted 1256
5 SASI_Hs01_00055847 predicted 373
6 SASI_Hs01_00055848 predicted 1392
7 SASI_Hs02_00305776 predicted 383
8 SASI_Hs01_00055849 predicted 1509
9 SASI_Hs02_00305777 predicted 1387
10 SASI_Hs01_00055850 predicted 1571
11 SASI_Hs01_00055845 predicted 1216
12 SASI_Hs01_00055851 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182990 predicted 385
2 SASI_Hs01_00182991 predicted 372
3 SASI_Hs01_00182992 predicted 1609
4 SASI_Hs01_00182994 predicted 1317
5 SASI_Hs01_00182995 predicted 377
6 SASI_Hs01_00182996 predicted 1457
7 SASI_Hs02_00360179 predicted 381
8 SASI_Hs01_00182997 predicted 1575
9 SASI_Hs02_00360180 predicted 1458
10 SASI_Hs01_00182998 predicted 1645
11 SASI_Hs01_00182993 predicted 1280
12 SASI_Hs01_00182999 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014236 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032512 predicted 812
2 SASI_Rn01_00032513 predicted 193
3 SASI_Rn02_00201784 predicted 749
4 SASI_Rn02_00201785 predicted 257
5 SASI_Rn01_00032515 predicted 388
6 SASI_Rn02_00201786 predicted 931
7 SASI_Rn02_00201787 predicted 912
8 SASI_Rn01_00032516 predicted 309
9 SASI_Rn01_00032517 predicted 332
10 SASI_Rn01_00032518 predicted 1028
11 SASI_Rn01_00032511 predicted 921
12 SASI_Rn01_00032514 predicted 250
13 SASI_Rn01_00032519 predicted 385
14 SASI_Rn01_00032520 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133772 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114351 predicted 880
2 SASI_Mm01_00114352 predicted 764
3 SASI_Mm01_00114353 predicted 211
4 SASI_Mm01_00114354 predicted 868
5 SASI_Mm01_00114355 predicted 456
6 SASI_Mm01_00114356 predicted 293
7 SASI_Mm01_00114357 predicted 262
8 SASI_Mm01_00114358 predicted 203
9 SASI_Mm01_00114359 predicted 1176
10 SASI_Mm01_00114360 predicted 339
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032627
VALIDATED
SSBP4 MISSION shRNA Bacterial Glycerol Stock
single stranded DNA binding protein 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032627.1-286s1c1
Sequence:CCGGGCTGTACGTTTATGAGTACCTCTCGAGAGGTACTCATAAACGTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032627.1-1315s1c1
Sequence:CCGGCGGGACCTTCCTGCACCCGTTCTCGAGAACGGGTGCAGGAAGGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032627.1-1053s1c1
Sequence:CCGGGCCCTGGAGATTCCACCAACTCTCGAGAGTTGGTGGAATCTCCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_032627.1-655s1c1
Sequence:CCGGGCCCTTCATGTCACCGCGCTTCTCGAGAAGCGCGGTGACATGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032627.1-271s1c1
Sequence:CCGGCCGCGAGAAGTTGGCGCTGTACTCGAGTACAGCGCCAACTTCTCGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032627.2-382s21c1
Sequence:CCGGAGTTGGCGCTGTACGTTTATGCTCGAGCATAAACGTACAGCGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032627.2-457s21c1
Sequence:CCGGTCCGATGGGAGAAGAACATCACTCGAGTGATGTTCTTCTCCCATCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032627.2-583s21c1
Sequence:CCGGCCAAGGCCTTCCAGGACTATACTCGAGTATAGTCCTGGAAGGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032627.2-1616s21c1
Sequence:CCGGCACGAAAGACTCTTACCATTTCTCGAGAAATGGTAAGAGTCTTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032627.2-758s21c1
Sequence:CCGGGCCCTTCATGTCACCGCGCTTCTCGAGAAGCGCGGTGACATGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032627
VALIDATED
SSBP4 MISSION shRNA shRNA Plasmid DNA
single stranded DNA binding protein 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032627.1-286s1c1
Sequence:CCGGGCTGTACGTTTATGAGTACCTCTCGAGAGGTACTCATAAACGTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032627.1-1315s1c1
Sequence:CCGGCGGGACCTTCCTGCACCCGTTCTCGAGAACGGGTGCAGGAAGGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032627.1-1053s1c1
Sequence:CCGGGCCCTGGAGATTCCACCAACTCTCGAGAGTTGGTGGAATCTCCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_032627.1-655s1c1
Sequence:CCGGGCCCTTCATGTCACCGCGCTTCTCGAGAAGCGCGGTGACATGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032627.1-271s1c1
Sequence:CCGGCCGCGAGAAGTTGGCGCTGTACTCGAGTACAGCGCCAACTTCTCGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032627.2-382s21c1
Sequence:CCGGAGTTGGCGCTGTACGTTTATGCTCGAGCATAAACGTACAGCGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032627.2-457s21c1
Sequence:CCGGTCCGATGGGAGAAGAACATCACTCGAGTGATGTTCTTCTCCCATCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032627.2-583s21c1
Sequence:CCGGCCAAGGCCTTCCAGGACTATACTCGAGTATAGTCCTGGAAGGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032627.2-1616s21c1
Sequence:CCGGCACGAAAGACTCTTACCATTTCTCGAGAAATGGTAAGAGTCTTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032627.2-758s21c1
Sequence:CCGGGCCCTTCATGTCACCGCGCTTCTCGAGAAGCGCGGTGACATGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032627
VALIDATED
SSBP4 MISSION shRNA Lentiviral Transduction Particles
single stranded DNA binding protein 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032627.1-286s1c1
Sequence:CCGGGCTGTACGTTTATGAGTACCTCTCGAGAGGTACTCATAAACGTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032627.1-1315s1c1
Sequence:CCGGCGGGACCTTCCTGCACCCGTTCTCGAGAACGGGTGCAGGAAGGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032627.1-1053s1c1
Sequence:CCGGGCCCTGGAGATTCCACCAACTCTCGAGAGTTGGTGGAATCTCCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_032627.1-655s1c1
Sequence:CCGGGCCCTTCATGTCACCGCGCTTCTCGAGAAGCGCGGTGACATGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032627.1-271s1c1
Sequence:CCGGCCGCGAGAAGTTGGCGCTGTACTCGAGTACAGCGCCAACTTCTCGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032627.2-382s21c1
Sequence:CCGGAGTTGGCGCTGTACGTTTATGCTCGAGCATAAACGTACAGCGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032627.2-457s21c1
Sequence:CCGGTCCGATGGGAGAAGAACATCACTCGAGTGATGTTCTTCTCCCATCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032627.2-583s21c1
Sequence:CCGGCCAAGGCCTTCCAGGACTATACTCGAGTATAGTCCTGGAAGGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032627.2-1616s21c1
Sequence:CCGGCACGAAAGACTCTTACCATTTCTCGAGAAATGGTAAGAGTCTTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032627.2-758s21c1
Sequence:CCGGGCCCTTCATGTCACCGCGCTTCTCGAGAAGCGCGGTGACATGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133772
VALIDATED
SSBP4 MISSION shRNA Bacterial Glycerol Stock
single stranded DNA binding protein 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133772.1-154s1c1
Sequence:CCGGGCGCTGTATGTATATGAGTATCTCGAGATACTCATATACATACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133772.1-657s1c1
Sequence:CCGGCCAGGGCTATGGAACTGGCATCTCGAGATGCCAGTTCCATAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133772.1-885s1c1
Sequence:CCGGCGAGAATATGTACACCATCATCTCGAGATGATGGTGTACATATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133772.1-215s1c1
Sequence:CCGGTGTCTGAGATCCGTTGGGAAACTCGAGTTTCCCAACGGATCTCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133772.1-882s1c1
Sequence:CCGGCAGCGAGAATATGTACACCATCTCGAGATGGTGTACATATTCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133772.1-885s21c1
Sequence:CCGGCGAGAATATGTACACCATCATCTCGAGATGATGGTGTACATATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133772.1-215s21c1
Sequence:CCGGTGTCTGAGATCCGTTGGGAAACTCGAGTTTCCCAACGGATCTCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133772.1-155s21c1
Sequence:CCGGCGCTGTATGTATATGAGTATCCTCGAGGATACTCATATACATACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133772.1-1168s21c1
Sequence:CCGGATGACCATGAGCGTGTGATAGCTCGAGCTATCACACGCTCATGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133772
VALIDATED
SSBP4 MISSION shRNA shRNA Plasmid DNA
single stranded DNA binding protein 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133772.1-154s1c1
Sequence:CCGGGCGCTGTATGTATATGAGTATCTCGAGATACTCATATACATACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133772.1-657s1c1
Sequence:CCGGCCAGGGCTATGGAACTGGCATCTCGAGATGCCAGTTCCATAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133772.1-885s1c1
Sequence:CCGGCGAGAATATGTACACCATCATCTCGAGATGATGGTGTACATATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133772.1-215s1c1
Sequence:CCGGTGTCTGAGATCCGTTGGGAAACTCGAGTTTCCCAACGGATCTCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133772.1-882s1c1
Sequence:CCGGCAGCGAGAATATGTACACCATCTCGAGATGGTGTACATATTCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133772.1-885s21c1
Sequence:CCGGCGAGAATATGTACACCATCATCTCGAGATGATGGTGTACATATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133772.1-215s21c1
Sequence:CCGGTGTCTGAGATCCGTTGGGAAACTCGAGTTTCCCAACGGATCTCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133772.1-155s21c1
Sequence:CCGGCGCTGTATGTATATGAGTATCCTCGAGGATACTCATATACATACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133772.1-1168s21c1
Sequence:CCGGATGACCATGAGCGTGTGATAGCTCGAGCTATCACACGCTCATGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133772
VALIDATED
SSBP4 MISSION shRNA Lentiviral Transduction Particles
single stranded DNA binding protein 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133772.1-154s1c1
Sequence:CCGGGCGCTGTATGTATATGAGTATCTCGAGATACTCATATACATACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133772.1-657s1c1
Sequence:CCGGCCAGGGCTATGGAACTGGCATCTCGAGATGCCAGTTCCATAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133772.1-885s1c1
Sequence:CCGGCGAGAATATGTACACCATCATCTCGAGATGATGGTGTACATATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133772.1-215s1c1
Sequence:CCGGTGTCTGAGATCCGTTGGGAAACTCGAGTTTCCCAACGGATCTCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133772.1-882s1c1
Sequence:CCGGCAGCGAGAATATGTACACCATCTCGAGATGGTGTACATATTCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133772.1-885s21c1
Sequence:CCGGCGAGAATATGTACACCATCATCTCGAGATGATGGTGTACATATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133772.1-215s21c1
Sequence:CCGGTGTCTGAGATCCGTTGGGAAACTCGAGTTTCCCAACGGATCTCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133772.1-155s21c1
Sequence:CCGGCGCTGTATGTATATGAGTATCCTCGAGGATACTCATATACATACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133772.1-1168s21c1
Sequence:CCGGATGACCATGAGCGTGTGATAGCTCGAGCTATCACACGCTCATGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks