EMAIL THIS PAGE TO A FRIEND

SSC5D

scavenger receptor cysteine rich domain containing (5 domains)

UniProtKB ID: A1L4H1, B5MDQ5, C7S7T9, C7S7U0
Gene ID:
Mouse(269855) scavenger receptor cysteine rich domain containing (5 domains)
Rat(308341) scavenger receptor cysteine rich domain containing (5 domains)
cow(530828) scavenger receptor cysteine rich domain containing (5 domains)
sheep(101119500) scavenger receptor cysteine rich domain containing (5 domains)
naked mole-rat(101701820) scavenger receptor cysteine rich domain containing (5 domains)
domestic guinea pig(100734138) scavenger receptor cysteine rich domain containing (5 domains)
Horse(100072730) scavenger receptor cysteine rich domain containing (5 domains)
dog(611280) scavenger receptor cysteine rich domain containing (5 domains)
domestic cat(101089814) scavenger receptor cysteine rich domain containing (5 domains)
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001144950 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001144950 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001144950 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173008 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173008 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173008 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_375654 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_375654 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_375654 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU040881 MISSION® esiRNA esiRNA targeting mouse A430110N23Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182571 Rosetta Predictions human pricing
XM_001718392 Rosetta Predictions human pricing
XM_001718440 Rosetta Predictions human pricing
XM_001719242 Rosetta Predictions human pricing
NM_001134545 Rosetta Predictions rat pricing
NM_173008 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133324 predicted 327
2 SASI_Hs01_00133325 predicted 324
3 SASI_Hs01_00133326 predicted 223
4 SASI_Hs01_00133327 predicted 117
5 SASI_Hs01_00133328 predicted 237
6 SASI_Hs01_00133329 predicted 224
7 SASI_Hs01_00133330 predicted 116
8 SASI_Hs01_00133331 predicted 214
9 SASI_Hs01_00133332 predicted 128
10 SASI_Hs01_00133333 predicted 107
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00423580 predicted 3183
2 SASI_Hs02_00423581 predicted 2302
3 SASI_Hs02_00423582 predicted 2106
4 SASI_Hs02_00423583 predicted 2384
5 SASI_Hs02_00423584 predicted 2320
6 SASI_Hs02_00423585 predicted 2704
7 SASI_Hs02_00423586 predicted 2151
8 SASI_Hs02_00423587 predicted 2009
9 SASI_Hs02_00423588 predicted 2556
10 SASI_Hs02_00423589 predicted 3147
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00423931 predicted 3414
2 SASI_Hs02_00423932 predicted 2295
3 SASI_Hs02_00423933 predicted 3069
4 SASI_Hs02_00423934 predicted 2104
5 SASI_Hs02_00423935 predicted 2382
6 SASI_Hs02_00423936 predicted 2702
7 SASI_Hs02_00423937 predicted 3094
8 SASI_Hs02_00423938 predicted 2017
9 SASI_Hs02_00423939 predicted 2555
10 SASI_Hs02_00423940 predicted 3379
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00429021 predicted 3412
2 SASI_Hs02_00429022 predicted 2302
3 SASI_Hs02_00429023 predicted 3076
4 SASI_Hs02_00429024 predicted 2103
5 SASI_Hs02_00429025 predicted 2384
6 SASI_Hs02_00429026 predicted 2699
7 SASI_Hs02_00429027 predicted 2150
8 SASI_Hs02_00429028 predicted 3086
9 SASI_Hs02_00429029 predicted 2010
10 SASI_Hs02_00429030 predicted 2555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134545 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256939 predicted 2861
2 SASI_Rn02_00256940 predicted 2792
3 SASI_Rn02_00256941 predicted 4137
4 SASI_Rn02_00256942 predicted 3172
5 SASI_Rn02_00256943 predicted 1990
6 SASI_Rn02_00256944 predicted 3985
7 SASI_Rn02_00256945 predicted 2115
8 SASI_Rn02_00256946 predicted 3876
9 SASI_Rn02_00256947 predicted 2549
10 SASI_Rn02_00256948 predicted 3274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173008 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099702 predicted 345
2 SASI_Mm01_00099703 predicted 1890
3 SASI_Mm01_00099704 predicted 2780
4 SASI_Mm01_00099705 predicted 1217
5 SASI_Mm01_00099706 predicted 3861
6 SASI_Mm01_00099707 predicted 3399
7 SASI_Mm01_00099708 predicted 1821
8 SASI_Mm01_00099709 predicted 3672
9 SASI_Mm01_00099710 predicted 3839
10 SASI_Mm02_00345053 predicted 3938
11 SASI_Mm01_00099701 predicted 3133
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001144950
SSC5D MISSION shRNA Bacterial Glycerol Stock
scavenger receptor cysteine rich domain containing (5 domains)
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000378825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144950.1-2266s21c1
Sequence:CCGGGAGTCCACTATCAAGAGTATCCTCGAGGATACTCTTGATAGTGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144950.1-3275s21c1
Sequence:CCGGTCTTGACAAGCCCTGACTTTGCTCGAGCAAAGTCAGGGCTTGTCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144950.1-2707s21c1
Sequence:CCGGTACACAGACTATGACGATTATCTCGAGATAATCGTCATAGTCTGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001144950
SSC5D MISSION shRNA shRNA Plasmid DNA
scavenger receptor cysteine rich domain containing (5 domains)
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000378825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144950.1-2266s21c1
Sequence:CCGGGAGTCCACTATCAAGAGTATCCTCGAGGATACTCTTGATAGTGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144950.1-3275s21c1
Sequence:CCGGTCTTGACAAGCCCTGACTTTGCTCGAGCAAAGTCAGGGCTTGTCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144950.1-2707s21c1
Sequence:CCGGTACACAGACTATGACGATTATCTCGAGATAATCGTCATAGTCTGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001144950
SSC5D MISSION shRNA Lentiviral Transduction Particles
scavenger receptor cysteine rich domain containing (5 domains)
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000378825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144950.1-2266s21c1
Sequence:CCGGGAGTCCACTATCAAGAGTATCCTCGAGGATACTCTTGATAGTGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144950.1-3275s21c1
Sequence:CCGGTCTTGACAAGCCCTGACTTTGCTCGAGCAAAGTCAGGGCTTGTCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144950.1-2707s21c1
Sequence:CCGGTACACAGACTATGACGATTATCTCGAGATAATCGTCATAGTCTGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173008
SSC5D MISSION shRNA Bacterial Glycerol Stock
scavenger receptor cysteine rich domain containing (5 domains)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173008.1-3396s1c1
Sequence:CCGGCACCTGAAATAATCCCAGAAACTCGAGTTTCTGGGATTATTTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173008.1-2694s1c1
Sequence:CCGGCGGGTGATGACGATTATCCTTCTCGAGAAGGATAATCGTCATCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173008.1-3320s1c1
Sequence:CCGGGCCTCCTCTATGCTATCAGAACTCGAGTTCTGATAGCATAGAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173008.1-3489s1c1
Sequence:CCGGGCATCCCTCAACTCAACACAACTCGAGTTGTGTTGAGTTGAGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173008.1-3648s1c1
Sequence:CCGGCCTCCCGAAAGACAGAACTTTCTCGAGAAAGTTCTGTCTTTCGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173008
SSC5D MISSION shRNA shRNA Plasmid DNA
scavenger receptor cysteine rich domain containing (5 domains)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173008.1-3396s1c1
Sequence:CCGGCACCTGAAATAATCCCAGAAACTCGAGTTTCTGGGATTATTTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173008.1-2694s1c1
Sequence:CCGGCGGGTGATGACGATTATCCTTCTCGAGAAGGATAATCGTCATCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173008.1-3320s1c1
Sequence:CCGGGCCTCCTCTATGCTATCAGAACTCGAGTTCTGATAGCATAGAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173008.1-3489s1c1
Sequence:CCGGGCATCCCTCAACTCAACACAACTCGAGTTGTGTTGAGTTGAGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173008.1-3648s1c1
Sequence:CCGGCCTCCCGAAAGACAGAACTTTCTCGAGAAAGTTCTGTCTTTCGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173008
SSC5D MISSION shRNA Lentiviral Transduction Particles
scavenger receptor cysteine rich domain containing (5 domains)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173008.1-3396s1c1
Sequence:CCGGCACCTGAAATAATCCCAGAAACTCGAGTTTCTGGGATTATTTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173008.1-2694s1c1
Sequence:CCGGCGGGTGATGACGATTATCCTTCTCGAGAAGGATAATCGTCATCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173008.1-3320s1c1
Sequence:CCGGGCCTCCTCTATGCTATCAGAACTCGAGTTCTGATAGCATAGAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173008.1-3489s1c1
Sequence:CCGGGCATCCCTCAACTCAACACAACTCGAGTTGTGTTGAGTTGAGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173008.1-3648s1c1
Sequence:CCGGCCTCCCGAAAGACAGAACTTTCTCGAGAAAGTTCTGTCTTTCGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_375654
SSC5D MISSION shRNA Bacterial Glycerol Stock
scavenger receptor cysteine rich domain containing (5 domains)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203934    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375654.1-1564s1c1
Sequence:CCGGCCGTTTGTTTAAGCCTCAGTTCTCGAGAACTGAGGCTTAAACAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185779    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375654.1-2694s1c1
Sequence:CCGGCCAAGAAAGGAAACAAATGAACTCGAGTTCATTTGTTTCCTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375654.1-2854s1c1
Sequence:CCGGGCTCTTCTCTAGAACAGTGATCTCGAGATCACTGTTCTAGAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186776    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375654.1-2691s1c1
Sequence:CCGGGTGCCAAGAAAGGAAACAAATCTCGAGATTTGTTTCCTTTCTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186013    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375654.1-2042s1c1
Sequence:CCGGCTTTCCTTCCACAAATCTTTACTCGAGTAAAGATTTGTGGAAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186409    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375654.1-1565s1c1
Sequence:CCGGCGTTTGTTTAAGCCTCAGTTTCTCGAGAAACTGAGGCTTAAACAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_375654
SSC5D MISSION shRNA shRNA Plasmid DNA
scavenger receptor cysteine rich domain containing (5 domains)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203934    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375654.1-1564s1c1
Sequence:CCGGCCGTTTGTTTAAGCCTCAGTTCTCGAGAACTGAGGCTTAAACAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185779    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375654.1-2694s1c1
Sequence:CCGGCCAAGAAAGGAAACAAATGAACTCGAGTTCATTTGTTTCCTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375654.1-2854s1c1
Sequence:CCGGGCTCTTCTCTAGAACAGTGATCTCGAGATCACTGTTCTAGAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186776    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375654.1-2691s1c1
Sequence:CCGGGTGCCAAGAAAGGAAACAAATCTCGAGATTTGTTTCCTTTCTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186013    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375654.1-2042s1c1
Sequence:CCGGCTTTCCTTCCACAAATCTTTACTCGAGTAAAGATTTGTGGAAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186409    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375654.1-1565s1c1
Sequence:CCGGCGTTTGTTTAAGCCTCAGTTTCTCGAGAAACTGAGGCTTAAACAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_375654
SSC5D MISSION shRNA Lentiviral Transduction Particles
scavenger receptor cysteine rich domain containing (5 domains)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203934    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375654.1-1564s1c1
Sequence:CCGGCCGTTTGTTTAAGCCTCAGTTCTCGAGAACTGAGGCTTAAACAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185779    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375654.1-2694s1c1
Sequence:CCGGCCAAGAAAGGAAACAAATGAACTCGAGTTCATTTGTTTCCTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375654.1-2854s1c1
Sequence:CCGGGCTCTTCTCTAGAACAGTGATCTCGAGATCACTGTTCTAGAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186776    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375654.1-2691s1c1
Sequence:CCGGGTGCCAAGAAAGGAAACAAATCTCGAGATTTGTTTCCTTTCTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186013    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375654.1-2042s1c1
Sequence:CCGGCTTTCCTTCCACAAATCTTTACTCGAGTAAAGATTTGTGGAAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186409    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_375654.1-1565s1c1
Sequence:CCGGCGTTTGTTTAAGCCTCAGTTTCTCGAGAAACTGAGGCTTAAACAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks