EMAIL THIS PAGE TO A FRIEND

SSFA2

sperm specific antigen 2

Synonyms: CS-1 CS1 KRAP SPAG13
Gene ID:
Mouse(70599) sperm specific antigen 2
Rat(311146) sperm specific antigen 2
domestic guinea pig(100717506) sperm specific antigen 2
naked mole-rat(101710429) sperm specific antigen 2
cow(538826) sperm specific antigen 2
sheep(101120052) sperm specific antigen 2
Zebrafish(553255) sperm specific antigen 2
Horse(100053992) sperm specific antigen 2
chicken(424118) sperm specific antigen 2
dog(478824) sperm specific antigen 2
domestic cat(101082254) sperm specific antigen 2
261 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080558 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080558 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080558 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006751 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006751 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006751 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006751 Rosetta Predictions human pricing
NM_001107738 Rosetta Predictions rat pricing
NM_080558 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179621 predicted 955
2 SASI_Hs01_00179623 predicted 1507
3 SASI_Hs01_00179624 predicted 1666
4 SASI_Hs01_00179625 predicted 1781
5 SASI_Hs02_00342227 predicted 2482
6 SASI_Hs01_00179626 predicted 3677
7 SASI_Hs02_00342228 predicted 1750
8 SASI_Hs01_00179627 predicted 1209
9 SASI_Hs01_00179628 predicted 1704
10 SASI_Hs01_00179629 predicted 3407
11 SASI_Hs01_00179620 predicted 2313
12 SASI_Hs01_00179622 predicted 1223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107738 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231785 predicted 2453
2 SASI_Rn02_00231786 predicted 3056
3 SASI_Rn02_00231787 predicted 949
4 SASI_Rn02_00231788 predicted 536
5 SASI_Rn02_00231789 predicted 1112
6 SASI_Rn02_00231790 predicted 2827
7 SASI_Rn02_00231791 predicted 4013
8 SASI_Rn02_00231792 predicted 713
9 SASI_Rn02_00231793 predicted 2534
10 SASI_Rn02_00231794 predicted 2413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080558 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338160 predicted 3893
2 SASI_Mm01_00065147 predicted 616
3 SASI_Mm01_00065150 predicted 1191
4 SASI_Mm02_00338161 predicted 3317
5 SASI_Mm02_00338162 predicted 1567
6 SASI_Mm02_00338163 predicted 3793
7 SASI_Mm01_00065151 predicted 2466
8 SASI_Mm01_00065152 predicted 539
9 SASI_Mm01_00065154 predicted 910
10 SASI_Mm01_00065155 predicted 841
11 SASI_Mm01_00065146 predicted 2206
12 SASI_Mm01_00065148 predicted 3212
13 SASI_Mm01_00065149 predicted 2836
14 SASI_Mm01_00065153 predicted 1022
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080558
VALIDATED
SSFA2 MISSION shRNA Bacterial Glycerol Stock
sperm specific antigen 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080558.3-2250s1c1
Sequence:CCGGGTCTTCTGTCAATGTGCGATTCTCGAGAATCGCACATTGACAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080558.3-1383s1c1
Sequence:CCGGGCAGAAAGACTCCTTTGAGATCTCGAGATCTCAAAGGAGTCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_080558.3-1764s1c1
Sequence:CCGGGAAAGCCGACAACCAAGATTTCTCGAGAAATCTTGGTTGTCGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_080558.3-3146s1c1
Sequence:CCGGGCAGGAGCGTAGATAACTTATCTCGAGATAAGTTATCTACGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080558.3-2728s1c1
Sequence:CCGGCGGAGAGTGTTGCATGATATTCTCGAGAATATCATGCAACACTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_080558.3-1458s1c1
Sequence:CCGGGCTAAGTCTTGCCAAGTCAAACTCGAGTTTGACTTGGCAAGACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080558.3-1970s1c1
Sequence:CCGGCCACACACCATATTCTCAGATCTCGAGATCTGAGAATATGGTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_080558.3-355s1c1
Sequence:CCGGGAAGCCAATCACCTACATGAACTCGAGTTCATGTAGGTGATTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080558.3-625s1c1
Sequence:CCGGGCCAGAGGCATAGACATTAAACTCGAGTTTAATGTCTATGCCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_080558.3-2124s1c1
Sequence:CCGGAGTAGGGCGTAGCCTAATAAACTCGAGTTTATTAGGCTACGCCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080558
VALIDATED
SSFA2 MISSION shRNA shRNA Plasmid DNA
sperm specific antigen 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080558.3-2250s1c1
Sequence:CCGGGTCTTCTGTCAATGTGCGATTCTCGAGAATCGCACATTGACAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080558.3-1383s1c1
Sequence:CCGGGCAGAAAGACTCCTTTGAGATCTCGAGATCTCAAAGGAGTCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_080558.3-1764s1c1
Sequence:CCGGGAAAGCCGACAACCAAGATTTCTCGAGAAATCTTGGTTGTCGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_080558.3-3146s1c1
Sequence:CCGGGCAGGAGCGTAGATAACTTATCTCGAGATAAGTTATCTACGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080558.3-2728s1c1
Sequence:CCGGCGGAGAGTGTTGCATGATATTCTCGAGAATATCATGCAACACTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_080558.3-1458s1c1
Sequence:CCGGGCTAAGTCTTGCCAAGTCAAACTCGAGTTTGACTTGGCAAGACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080558.3-1970s1c1
Sequence:CCGGCCACACACCATATTCTCAGATCTCGAGATCTGAGAATATGGTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_080558.3-355s1c1
Sequence:CCGGGAAGCCAATCACCTACATGAACTCGAGTTCATGTAGGTGATTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080558.3-625s1c1
Sequence:CCGGGCCAGAGGCATAGACATTAAACTCGAGTTTAATGTCTATGCCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_080558.3-2124s1c1
Sequence:CCGGAGTAGGGCGTAGCCTAATAAACTCGAGTTTATTAGGCTACGCCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080558
VALIDATED
SSFA2 MISSION shRNA Lentiviral Transduction Particles
sperm specific antigen 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080558.3-2250s1c1
Sequence:CCGGGTCTTCTGTCAATGTGCGATTCTCGAGAATCGCACATTGACAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080558.3-1383s1c1
Sequence:CCGGGCAGAAAGACTCCTTTGAGATCTCGAGATCTCAAAGGAGTCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_080558.3-1764s1c1
Sequence:CCGGGAAAGCCGACAACCAAGATTTCTCGAGAAATCTTGGTTGTCGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_080558.3-3146s1c1
Sequence:CCGGGCAGGAGCGTAGATAACTTATCTCGAGATAAGTTATCTACGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080558.3-2728s1c1
Sequence:CCGGCGGAGAGTGTTGCATGATATTCTCGAGAATATCATGCAACACTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_080558.3-1458s1c1
Sequence:CCGGGCTAAGTCTTGCCAAGTCAAACTCGAGTTTGACTTGGCAAGACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080558.3-1970s1c1
Sequence:CCGGCCACACACCATATTCTCAGATCTCGAGATCTGAGAATATGGTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_080558.3-355s1c1
Sequence:CCGGGAAGCCAATCACCTACATGAACTCGAGTTCATGTAGGTGATTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080558.3-625s1c1
Sequence:CCGGGCCAGAGGCATAGACATTAAACTCGAGTTTAATGTCTATGCCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_080558.3-2124s1c1
Sequence:CCGGAGTAGGGCGTAGCCTAATAAACTCGAGTTTATTAGGCTACGCCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006751
SSFA2 MISSION shRNA Bacterial Glycerol Stock
sperm specific antigen 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006751.3-1460s1c1
Sequence:CCGGCCACTGACAATACCATCCATACTCGAGTATGGATGGTATTGTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121696    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006751.3-4161s1c1
Sequence:CCGGCTGTGCAATAACTGATTCATTCTCGAGAATGAATCAGTTATTGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006751.3-3807s1c1
Sequence:CCGGGCTGTGTAATACTGGAATTATCTCGAGATAATTCCAGTATTACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121851    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006751.3-4574s1c1
Sequence:CCGGGAAATGAATAAGCTGGTGTTTCTCGAGAAACACCAGCTTATTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006751.3-3837s1c1
Sequence:CCGGGCACTGGTGGAGGTGTTATTTCTCGAGAAATAACACCTCCACCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006751.3-1624s1c1
Sequence:CCGGGCATTCCGATAGCAGTGGTTTCTCGAGAAACCACTGCTATCGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006751.3-1573s1c1
Sequence:CCGGGCTAGGTCTTACGAAGTCGAACTCGAGTTCGACTTCGTAAGACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006751.3-2522s1c1
Sequence:CCGGCCATCATCTGTGAAGAAAGAACTCGAGTTCTTTCTTCACAGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144703    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006751.3-4376s1c1
Sequence:CCGGGCTTTACCCAAGACAAATGTACTCGAGTACATTTGTCTTGGGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144343    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006751.3-4082s1c1
Sequence:CCGGCTTCCAGACTTATCCAACTTACTCGAGTAAGTTGGATAAGTCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006751
SSFA2 MISSION shRNA shRNA Plasmid DNA
sperm specific antigen 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006751.3-1460s1c1
Sequence:CCGGCCACTGACAATACCATCCATACTCGAGTATGGATGGTATTGTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121696    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006751.3-4161s1c1
Sequence:CCGGCTGTGCAATAACTGATTCATTCTCGAGAATGAATCAGTTATTGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006751.3-3807s1c1
Sequence:CCGGGCTGTGTAATACTGGAATTATCTCGAGATAATTCCAGTATTACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121851    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006751.3-4574s1c1
Sequence:CCGGGAAATGAATAAGCTGGTGTTTCTCGAGAAACACCAGCTTATTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006751.3-3837s1c1
Sequence:CCGGGCACTGGTGGAGGTGTTATTTCTCGAGAAATAACACCTCCACCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006751.3-1624s1c1
Sequence:CCGGGCATTCCGATAGCAGTGGTTTCTCGAGAAACCACTGCTATCGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006751.3-1573s1c1
Sequence:CCGGGCTAGGTCTTACGAAGTCGAACTCGAGTTCGACTTCGTAAGACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006751.3-2522s1c1
Sequence:CCGGCCATCATCTGTGAAGAAAGAACTCGAGTTCTTTCTTCACAGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144703    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006751.3-4376s1c1
Sequence:CCGGGCTTTACCCAAGACAAATGTACTCGAGTACATTTGTCTTGGGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144343    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006751.3-4082s1c1
Sequence:CCGGCTTCCAGACTTATCCAACTTACTCGAGTAAGTTGGATAAGTCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006751
SSFA2 MISSION shRNA Lentiviral Transduction Particles
sperm specific antigen 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006751.3-1460s1c1
Sequence:CCGGCCACTGACAATACCATCCATACTCGAGTATGGATGGTATTGTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121696    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006751.3-4161s1c1
Sequence:CCGGCTGTGCAATAACTGATTCATTCTCGAGAATGAATCAGTTATTGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006751.3-3807s1c1
Sequence:CCGGGCTGTGTAATACTGGAATTATCTCGAGATAATTCCAGTATTACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121851    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006751.3-4574s1c1
Sequence:CCGGGAAATGAATAAGCTGGTGTTTCTCGAGAAACACCAGCTTATTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006751.3-3837s1c1
Sequence:CCGGGCACTGGTGGAGGTGTTATTTCTCGAGAAATAACACCTCCACCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006751.3-1624s1c1
Sequence:CCGGGCATTCCGATAGCAGTGGTTTCTCGAGAAACCACTGCTATCGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006751.3-1573s1c1
Sequence:CCGGGCTAGGTCTTACGAAGTCGAACTCGAGTTCGACTTCGTAAGACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006751.3-2522s1c1
Sequence:CCGGCCATCATCTGTGAAGAAAGAACTCGAGTTCTTTCTTCACAGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144703    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006751.3-4376s1c1
Sequence:CCGGGCTTTACCCAAGACAAATGTACTCGAGTACATTTGTCTTGGGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144343    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006751.3-4082s1c1
Sequence:CCGGCTTCCAGACTTATCCAACTTACTCGAGTAAGTTGGATAAGTCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks