EMAIL THIS PAGE TO A FRIEND

SSH1

slingshot protein phosphatase 1

Synonyms: SSH1L
UniProtKB ID: Q8WYL5, Q6P6C0, Q8N9A7, Q8WYL3, Q8WYL4, Q9P2P8
Gene ID:
Human(54434) Summary: The protein encoded by this gene belongs to the slingshot homolog (SSH) family of phosphatases, which regulate actin filament dynamics. The SSH proteins dephosphorylate and activate the actin binding/depolymerizing factor cofilin, which subsequently binds to actin filaments and stimulates their disassembly. Cofilin is inactivated by kinases such as LIM domain kinase-1 (LIMK1), which may also be dephosphorylated and inactivated by SSH proteins. The SSH family thus appears to play a role in actin dynamics by reactivating cofilin proteins. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Mouse(231637) slingshot homolog 1 (Drosophila)
Rat(304580) slingshot protein phosphatase 1
chicken(427699) slingshot homolog 1 (Drosophila)
chicken(101668825) slingshot protein phosphatase 1
chicken(101750781) slingshot protein phosphatase 1
domestic cat(101094543) slingshot homolog 1 (Drosophila)
Horse(100066801) slingshot homolog 1 (Drosophila)
dog(477526) slingshot homolog 1 (Drosophila)
cow(538233) slingshot protein phosphatase 1
sheep(101116093) slingshot homolog 1 (Drosophila)
naked mole-rat(101714823) slingshot protein phosphatase 1
domestic guinea pig(100718532) slingshot protein phosphatase 1
Gene Class: Cytoskeleton
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018984 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018984 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018984 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198109 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198109 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198109 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU124171 MISSION® esiRNA esiRNA human SSH1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018984 Rosetta Predictions human pricing
NM_001107154 Rosetta Predictions rat pricing
NM_198109 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018984 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095218 predicted 1280
2 SASI_Hs01_00095219 predicted 969
3 SASI_Hs02_00352481 predicted 1411
4 SASI_Hs01_00095221 predicted 1190
5 SASI_Hs01_00095222 predicted 2465
6 SASI_Hs01_00095223 predicted 571
7 SASI_Hs01_00095224 predicted 924
8 SASI_Hs01_00095225 predicted 300
9 SASI_Hs01_00095226 predicted 579
10 SASI_Hs01_00095227 predicted 1279
11 SASI_Hs01_00095220 predicted 3316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107154 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226035 predicted 817
2 SASI_Rn02_00226036 predicted 1885
3 SASI_Rn02_00226037 predicted 897
4 SASI_Rn02_00226038 predicted 745
5 SASI_Rn02_00226039 predicted 1359
6 SASI_Rn02_00226040 predicted 1102
7 SASI_Rn02_00226041 predicted 990
8 SASI_Rn02_00226042 predicted 785
9 SASI_Rn02_00226043 predicted 1027
10 SASI_Rn02_00226044 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198109 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074350 predicted 1322
2 SASI_Mm02_00350838 predicted 948
3 SASI_Mm01_00074351 predicted 1040
4 SASI_Mm01_00074352 predicted 835
5 SASI_Mm01_00074353 predicted 1303
6 SASI_Mm01_00074354 predicted 2711
7 SASI_Mm01_00074355 predicted 2385
8 SASI_Mm01_00074356 predicted 895
9 SASI_Mm01_00074357 predicted 1224
10 SASI_Mm01_00074359 predicted 528
11 SASI_Mm01_00074358 predicted 904
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018984
VALIDATED
SSH1 MISSION shRNA Bacterial Glycerol Stock
slingshot protein phosphatase 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018984.3-1137s21c1
Sequence:GTACCGGTGGCTTATTTGCATATCATAACTCGAGTTATGATATGCAAATAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018984.2-1022s21c1
Sequence:CCGGCATCTTTATCTCGGCTCTGAACTCGAGTTCAGAGCCGAGATAAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018984.2-964s21c1
Sequence:CCGGAGACAATGAGATGCTACTTATCTCGAGATAAGTAGCATCTCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018984.2-1101s21c1
Sequence:CCGGTTACCAGAGAAATCGATAATTCTCGAGAATTATCGATTTCTCTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018984.3-901s21c1
Sequence:GTACCGGACTTCCAAAGAGATTCGTAATCTCGAGATTACGAATCTCTTTGGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018984.2-1966s21c1
Sequence:CCGGCATGGAGGATGATGCTATATTCTCGAGAATATAGCATCATCCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018984.2-3597s21c1
Sequence:CCGGCGGCACACGTTCTAGCTCATTCTCGAGAATGAGCTAGAACGTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018984.x-1566s1c1
Sequence:CCGGTGAGGATGAAACTGGCAGCTTCTCGAGAAGCTGCCAGTTTCATCCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018984.x-943s1c1
Sequence:CCGGCATCTTTATCTCGGCTCTGAACTCGAGTTCAGAGCCGAGATAAAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018984.x-1201s1c1
Sequence:CCGGGCCTCCACAGTCATAGCCTATCTCGAGATAGGCTATGACTGTGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018984.x-3518s1c1
Sequence:CCGGCGGCACACGTTCTAGCTCATTCTCGAGAATGAGCTAGAACGTGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018984
VALIDATED
SSH1 MISSION shRNA shRNA Plasmid DNA
slingshot protein phosphatase 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018984.3-1137s21c1
Sequence:GTACCGGTGGCTTATTTGCATATCATAACTCGAGTTATGATATGCAAATAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018984.2-1022s21c1
Sequence:CCGGCATCTTTATCTCGGCTCTGAACTCGAGTTCAGAGCCGAGATAAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018984.2-964s21c1
Sequence:CCGGAGACAATGAGATGCTACTTATCTCGAGATAAGTAGCATCTCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018984.2-1101s21c1
Sequence:CCGGTTACCAGAGAAATCGATAATTCTCGAGAATTATCGATTTCTCTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018984.3-901s21c1
Sequence:GTACCGGACTTCCAAAGAGATTCGTAATCTCGAGATTACGAATCTCTTTGGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018984.2-1966s21c1
Sequence:CCGGCATGGAGGATGATGCTATATTCTCGAGAATATAGCATCATCCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018984.2-3597s21c1
Sequence:CCGGCGGCACACGTTCTAGCTCATTCTCGAGAATGAGCTAGAACGTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018984.x-1566s1c1
Sequence:CCGGTGAGGATGAAACTGGCAGCTTCTCGAGAAGCTGCCAGTTTCATCCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018984.x-943s1c1
Sequence:CCGGCATCTTTATCTCGGCTCTGAACTCGAGTTCAGAGCCGAGATAAAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018984.x-1201s1c1
Sequence:CCGGGCCTCCACAGTCATAGCCTATCTCGAGATAGGCTATGACTGTGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018984.x-3518s1c1
Sequence:CCGGCGGCACACGTTCTAGCTCATTCTCGAGAATGAGCTAGAACGTGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018984
VALIDATED
SSH1 MISSION shRNA Lentiviral Transduction Particles
slingshot protein phosphatase 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018984.3-1137s21c1
Sequence:GTACCGGTGGCTTATTTGCATATCATAACTCGAGTTATGATATGCAAATAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018984.2-1022s21c1
Sequence:CCGGCATCTTTATCTCGGCTCTGAACTCGAGTTCAGAGCCGAGATAAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018984.2-964s21c1
Sequence:CCGGAGACAATGAGATGCTACTTATCTCGAGATAAGTAGCATCTCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018984.2-1101s21c1
Sequence:CCGGTTACCAGAGAAATCGATAATTCTCGAGAATTATCGATTTCTCTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018984.3-901s21c1
Sequence:GTACCGGACTTCCAAAGAGATTCGTAATCTCGAGATTACGAATCTCTTTGGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018984.2-1966s21c1
Sequence:CCGGCATGGAGGATGATGCTATATTCTCGAGAATATAGCATCATCCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018984.2-3597s21c1
Sequence:CCGGCGGCACACGTTCTAGCTCATTCTCGAGAATGAGCTAGAACGTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018984.x-1566s1c1
Sequence:CCGGTGAGGATGAAACTGGCAGCTTCTCGAGAAGCTGCCAGTTTCATCCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018984.x-943s1c1
Sequence:CCGGCATCTTTATCTCGGCTCTGAACTCGAGTTCAGAGCCGAGATAAAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018984.x-1201s1c1
Sequence:CCGGGCCTCCACAGTCATAGCCTATCTCGAGATAGGCTATGACTGTGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018984.x-3518s1c1
Sequence:CCGGCGGCACACGTTCTAGCTCATTCTCGAGAATGAGCTAGAACGTGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198109
VALIDATED
SSH1 MISSION shRNA Bacterial Glycerol Stock
slingshot protein phosphatase 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000081243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198109.2-2744s1c1
Sequence:CCGGCCCGTTTAGATCACACCAGTACTCGAGTACTGGTGTGATCTAAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198109.2-906s1c1
Sequence:CCGGGCAAATGAACTGCAACCTGAACTCGAGTTCAGGTTGCAGTTCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198109.2-1963s1c1
Sequence:CCGGCGCGATGCCATGTTTGGAATTCTCGAGAATTCCAAACATGGCATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198109.2-140s1c1
Sequence:CCGGGCAGCGATGAAGAACGGAAATCTCGAGATTTCCGTTCTTCATCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198109
VALIDATED
SSH1 MISSION shRNA shRNA Plasmid DNA
slingshot protein phosphatase 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000081243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198109.2-2744s1c1
Sequence:CCGGCCCGTTTAGATCACACCAGTACTCGAGTACTGGTGTGATCTAAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198109.2-906s1c1
Sequence:CCGGGCAAATGAACTGCAACCTGAACTCGAGTTCAGGTTGCAGTTCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198109.2-1963s1c1
Sequence:CCGGCGCGATGCCATGTTTGGAATTCTCGAGAATTCCAAACATGGCATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198109.2-140s1c1
Sequence:CCGGGCAGCGATGAAGAACGGAAATCTCGAGATTTCCGTTCTTCATCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198109
VALIDATED
SSH1 MISSION shRNA Lentiviral Transduction Particles
slingshot protein phosphatase 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000081243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198109.2-2744s1c1
Sequence:CCGGCCCGTTTAGATCACACCAGTACTCGAGTACTGGTGTGATCTAAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198109.2-906s1c1
Sequence:CCGGGCAAATGAACTGCAACCTGAACTCGAGTTCAGGTTGCAGTTCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198109.2-1963s1c1
Sequence:CCGGCGCGATGCCATGTTTGGAATTCTCGAGAATTCCAAACATGGCATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198109.2-140s1c1
Sequence:CCGGGCAGCGATGAAGAACGGAAATCTCGAGATTTCCGTTCTTCATCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks