EMAIL THIS PAGE TO A FRIEND

SSH2

slingshot protein phosphatase 2

Synonyms: SSH-2 SSH-2L
Gene ID:
Human(85464) Summary: The ADF (actin-depolymerizing factor)/cofilin family (see MIM 601442) is composed of stimulus-responsive mediators of actin dynamics. ADF/cofilin proteins are inactivated by kinases such as LIM domain kinase-1 (LIMK1; MIM 601329). The SSH family appears to play a role in actin dynamics by reactivating ADF/cofilin proteins in vivo (Niwa et al., 2002 [PubMed 11832213]
Mouse(237860) slingshot homolog 2 (Drosophila)
Rat(303342) slingshot protein phosphatase 2
chicken(417586) slingshot homolog 2 (Drosophila)
Horse(100072180) slingshot homolog 2 (Drosophila)
domestic cat(101083045) slingshot homolog 2 (Drosophila)
dog(491183) slingshot homolog 2 (Drosophila)
domestic guinea pig(100718589) slingshot protein phosphatase 2
naked mole-rat(101704392) slingshot protein phosphatase 2
Domestic Rabbit(100341119) slingshot homolog 2 (Drosophila)
cow(512652) slingshot protein phosphatase 2
sheep(101111299) slingshot homolog 2 (Drosophila)
Gene Class: Cytoskeleton
242 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177710 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177710 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177710 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033389 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033389 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033389 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033389 Rosetta Predictions human pricing
NM_001107024 Rosetta Predictions rat pricing
NM_177710 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101545 predicted 2664
2 SASI_Hs01_00101546 predicted 1748
3 SASI_Hs01_00101548 predicted 2480
4 SASI_Hs01_00101549 predicted 4042
5 SASI_Hs01_00101550 predicted 541
6 SASI_Hs01_00101551 predicted 630
7 SASI_Hs01_00101554 predicted 1982
8 SASI_Hs02_00361245 predicted 1147
9 SASI_Hs02_00361246 predicted 964
10 SASI_Hs02_00361247 predicted 388
11 SASI_Hs01_00101547 predicted 616
12 SASI_Hs01_00101552 predicted 1846
13 SASI_Hs01_00101553 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107024 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224736 predicted 1982
2 SASI_Rn02_00224737 predicted 481
3 SASI_Rn02_00224738 predicted 1780
4 SASI_Rn02_00224739 predicted 3865
5 SASI_Rn02_00224740 predicted 4197
6 SASI_Rn02_00224741 predicted 3200
7 SASI_Rn02_00224742 predicted 911
8 SASI_Rn02_00224743 predicted 2854
9 SASI_Rn02_00224744 predicted 2563
10 SASI_Rn02_00224745 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177710 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109882 predicted 4066
2 SASI_Mm01_00109883 predicted 664
3 SASI_Mm01_00109884 predicted 646
4 SASI_Mm01_00109885 predicted 603
5 SASI_Mm01_00109886 predicted 1739
6 SASI_Mm02_00348052 predicted 651
7 SASI_Mm01_00109888 predicted 2636
8 SASI_Mm01_00109889 predicted 2425
9 SASI_Mm01_00109890 predicted 1181
10 SASI_Mm01_00109891 predicted 1988
11 SASI_Mm01_00109887 predicted 1632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177710
VALIDATED
SSH2 MISSION shRNA Bacterial Glycerol Stock
slingshot protein phosphatase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177710.3-1169s1c1
Sequence:CCGGGCAAAGAAACATGGATCTAAACTCGAGTTTAGATCCATGTTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177710.3-2699s1c1
Sequence:CCGGCCCACATTATCCAATCGCAAACTCGAGTTTGCGATTGGATAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177710.3-3823s1c1
Sequence:CCGGCCTGGACCTTTGTAAAGACTACTCGAGTAGTCTTTACAAAGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177710.3-3296s1c1
Sequence:CCGGGCTGACCCAAACCCTATGTTACTCGAGTAACATAGGGTTTGGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177710.3-1280s1c1
Sequence:CCGGGCCTATGACTATGTGAAGGAACTCGAGTTCCTTCACATAGTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177710
VALIDATED
SSH2 MISSION shRNA shRNA Plasmid DNA
slingshot protein phosphatase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177710.3-1169s1c1
Sequence:CCGGGCAAAGAAACATGGATCTAAACTCGAGTTTAGATCCATGTTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177710.3-2699s1c1
Sequence:CCGGCCCACATTATCCAATCGCAAACTCGAGTTTGCGATTGGATAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177710.3-3823s1c1
Sequence:CCGGCCTGGACCTTTGTAAAGACTACTCGAGTAGTCTTTACAAAGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177710.3-3296s1c1
Sequence:CCGGGCTGACCCAAACCCTATGTTACTCGAGTAACATAGGGTTTGGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177710.3-1280s1c1
Sequence:CCGGGCCTATGACTATGTGAAGGAACTCGAGTTCCTTCACATAGTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177710
VALIDATED
SSH2 MISSION shRNA Lentiviral Transduction Particles
slingshot protein phosphatase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177710.3-1169s1c1
Sequence:CCGGGCAAAGAAACATGGATCTAAACTCGAGTTTAGATCCATGTTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177710.3-2699s1c1
Sequence:CCGGCCCACATTATCCAATCGCAAACTCGAGTTTGCGATTGGATAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177710.3-3823s1c1
Sequence:CCGGCCTGGACCTTTGTAAAGACTACTCGAGTAGTCTTTACAAAGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177710.3-3296s1c1
Sequence:CCGGGCTGACCCAAACCCTATGTTACTCGAGTAACATAGGGTTTGGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177710.3-1280s1c1
Sequence:CCGGGCCTATGACTATGTGAAGGAACTCGAGTTCCTTCACATAGTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033389
VALIDATED
SSH2 MISSION shRNA Bacterial Glycerol Stock
slingshot protein phosphatase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033389.2-5938s1c1
Sequence:CCGGCCTGTCATAAACAAGCCTCTTCTCGAGAAGAGGCTTGTTTATGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_033389.2-1249s1c1
Sequence:CCGGCGAGCCTATGACTATGTGAAACTCGAGTTTCACATAGTCATAGGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033389.2-300s1c1
Sequence:CCGGCCAGAATCGAACACGCTATATCTCGAGATATAGCGTGTTCGATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033389.2-3045s1c1
Sequence:CCGGCCACATAGTTACATCACCCAACTCGAGTTGGGTGATGTAACTATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_033389.2-1756s1c1
Sequence:CCGGGCCAACAAGTTTCCAGACTTACTCGAGTAAGTCTGGAAACTTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033389.2-301s21c1
Sequence:CCGGCAGAATCGAACACGCTATATGCTCGAGCATATAGCGTGTTCGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_033389.2-587s21c1
Sequence:CCGGACTACCCAGGCAGCCTATTTCCTCGAGGAAATAGGCTGCCTGGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_033389.2-895s21c1
Sequence:GTACCGGATAGTGATCCTTGGTCAAATGCTCGAGCATTTGACCAAGGATCACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033389.2-1060s21c1
Sequence:CCGGTATCATAACATTCGGGTATATCTCGAGATATACCCGAATGTTATGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033389.2-7403s21c1
Sequence:CCGGAGTACTATAGTACCGTAATATCTCGAGATATTACGGTACTATAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033389
VALIDATED
SSH2 MISSION shRNA shRNA Plasmid DNA
slingshot protein phosphatase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033389.2-5938s1c1
Sequence:CCGGCCTGTCATAAACAAGCCTCTTCTCGAGAAGAGGCTTGTTTATGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_033389.2-1249s1c1
Sequence:CCGGCGAGCCTATGACTATGTGAAACTCGAGTTTCACATAGTCATAGGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033389.2-300s1c1
Sequence:CCGGCCAGAATCGAACACGCTATATCTCGAGATATAGCGTGTTCGATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033389.2-3045s1c1
Sequence:CCGGCCACATAGTTACATCACCCAACTCGAGTTGGGTGATGTAACTATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_033389.2-1756s1c1
Sequence:CCGGGCCAACAAGTTTCCAGACTTACTCGAGTAAGTCTGGAAACTTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033389.2-301s21c1
Sequence:CCGGCAGAATCGAACACGCTATATGCTCGAGCATATAGCGTGTTCGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_033389.2-587s21c1
Sequence:CCGGACTACCCAGGCAGCCTATTTCCTCGAGGAAATAGGCTGCCTGGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_033389.2-895s21c1
Sequence:GTACCGGATAGTGATCCTTGGTCAAATGCTCGAGCATTTGACCAAGGATCACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033389.2-1060s21c1
Sequence:CCGGTATCATAACATTCGGGTATATCTCGAGATATACCCGAATGTTATGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033389.2-7403s21c1
Sequence:CCGGAGTACTATAGTACCGTAATATCTCGAGATATTACGGTACTATAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033389
VALIDATED
SSH2 MISSION shRNA Lentiviral Transduction Particles
slingshot protein phosphatase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033389.2-5938s1c1
Sequence:CCGGCCTGTCATAAACAAGCCTCTTCTCGAGAAGAGGCTTGTTTATGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_033389.2-1249s1c1
Sequence:CCGGCGAGCCTATGACTATGTGAAACTCGAGTTTCACATAGTCATAGGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033389.2-300s1c1
Sequence:CCGGCCAGAATCGAACACGCTATATCTCGAGATATAGCGTGTTCGATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033389.2-3045s1c1
Sequence:CCGGCCACATAGTTACATCACCCAACTCGAGTTGGGTGATGTAACTATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_033389.2-1756s1c1
Sequence:CCGGGCCAACAAGTTTCCAGACTTACTCGAGTAAGTCTGGAAACTTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033389.2-301s21c1
Sequence:CCGGCAGAATCGAACACGCTATATGCTCGAGCATATAGCGTGTTCGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_033389.2-587s21c1
Sequence:CCGGACTACCCAGGCAGCCTATTTCCTCGAGGAAATAGGCTGCCTGGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_033389.2-895s21c1
Sequence:GTACCGGATAGTGATCCTTGGTCAAATGCTCGAGCATTTGACCAAGGATCACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033389.2-1060s21c1
Sequence:CCGGTATCATAACATTCGGGTATATCTCGAGATATACCCGAATGTTATGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033389.2-7403s21c1
Sequence:CCGGAGTACTATAGTACCGTAATATCTCGAGATATTACGGTACTATAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks