EMAIL THIS PAGE TO A FRIEND

SSH3

slingshot protein phosphatase 3

Synonyms: SSH3L
Gene ID:
Human(54961) Summary: The ADF (actin-depolymerizing factor)/cofilin family (see MIM 601442) is composed of stimulus-responsive mediators of actin dynamics. ADF/cofilin proteins are inactivated by kinases such as LIM domain kinase-1 (LIMK1; MIM 601329). The SSH family appears to play a role in actin dynamics by reactivating ADF/cofilin proteins in vivo (Niwa et al., 2002 [PubMed 11832213]
Mouse(245857) slingshot homolog 3 (Drosophila)
Rat(365396) slingshot protein phosphatase 3
chicken(101665388) slingshot protein phosphatase 3
chicken(101752044) slingshot protein phosphatase 3
domestic cat(101091048) slingshot homolog 3 (Drosophila)
dog(483699) slingshot homolog 3 (Drosophila)
cow(514643) slingshot homolog 3 (Drosophila)
sheep(101118488) slingshot homolog 3 (Drosophila)
naked mole-rat(101707008) slingshot protein phosphatase 3
domestic guinea pig(100720871) slingshot protein phosphatase 3
126 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017857 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017857 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017857 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198113 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198113 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198113 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017857 Rosetta Predictions human pricing
NM_018276 Rosetta Predictions human pricing
NM_001012217 Rosetta Predictions rat pricing
XM_574599 Rosetta Predictions rat pricing
NM_198113 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350765 predicted 2101
2 SASI_Hs01_00210162 predicted 747
3 SASI_Hs01_00210164 predicted 707
4 SASI_Hs02_00350766 predicted 1796
5 SASI_Hs02_00350767 predicted 1900
6 SASI_Hs02_00350768 predicted 2136
7 SASI_Hs02_00350769 predicted 1218
8 SASI_Hs02_00350770 predicted 1763
9 SASI_Hs02_00350771 predicted 2264
10 SASI_Hs02_00350772 predicted 926
11 SASI_Hs01_00210159 predicted 2367
12 SASI_Hs01_00210160 predicted 721
13 SASI_Hs01_00210161 predicted 1183
14 SASI_Hs01_00210163 predicted 606
15 SASI_Hs01_00210165 predicted 478
16 SASI_Hs01_00210166 predicted 1118
17 SASI_Hs01_00210167 predicted 1270
18 SASI_Hs01_00210168 predicted 2393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218621 predicted 627
2 SASI_Hs01_00218622 predicted 1090
3 SASI_Hs01_00218623 predicted 653
4 SASI_Hs01_00218624 predicted 509
5 SASI_Hs01_00218625 predicted 936
6 SASI_Hs01_00218626 predicted 872
7 SASI_Hs01_00218627 predicted 614
8 SASI_Hs01_00218628 predicted 743
9 SASI_Hs01_00218629 predicted 386
10 SASI_Hs01_00218630 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012217 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088678 predicted 1179
2 SASI_Rn01_00088679 predicted 796
3 SASI_Rn01_00088680 predicted 678
4 SASI_Rn01_00088681 predicted 891
5 SASI_Rn01_00088682 predicted 1137
6 SASI_Rn01_00088683 predicted 1184
7 SASI_Rn01_00088684 predicted 1250
8 SASI_Rn01_00088686 predicted 1950
9 SASI_Rn02_00200473 predicted 1600
10 SASI_Rn01_00088687 predicted 570
11 SASI_Rn01_00088685 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574599 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00177970 predicted 1386
2 SASI_Rn01_00177971 predicted 1392
3 SASI_Rn01_00177972 predicted 1381
4 SASI_Rn01_00177973 predicted 1678
5 SASI_Rn01_00177974 predicted 1432
6 SASI_Rn01_00177975 predicted 1337
7 SASI_Rn01_00177976 predicted 1486
8 SASI_Rn01_00177977 predicted 1529
9 SASI_Rn01_00177978 predicted 1392
10 SASI_Rn01_00177979 predicted 1290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198113 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111373 predicted 2091
2 SASI_Mm02_00350860 predicted 1135
3 SASI_Mm01_00111374 predicted 807
4 SASI_Mm01_00111375 predicted 1203
5 SASI_Mm01_00111376 predicted 695
6 SASI_Mm01_00111377 predicted 1347
7 SASI_Mm01_00111378 predicted 1198
8 SASI_Mm01_00111379 predicted 471
9 SASI_Mm01_00111381 predicted 1268
10 SASI_Mm01_00111382 predicted 2066
11 SASI_Mm01_00111380 predicted 1162
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017857
VALIDATED
SSH3 MISSION shRNA Bacterial Glycerol Stock
slingshot protein phosphatase 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017857.3-2376s21c1
Sequence:CCGGGTCCAAGGGCTCAAGACTTTCCTCGAGGAAAGTCTTGAGCCCTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017857.3-1290s21c1
Sequence:CCGGAGCGCTTCACCTACCACAATGCTCGAGCATTGTGGTAGGTGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017857.3-2334s21c1
Sequence:CCGGCCTCACCTCCTACAGCCTTAACTCGAGTTAAGGCTGTAGGAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017857.3-684s21c1
Sequence:CCGGGTGACACCCAGGTGTACTTAGCTCGAGCTAAGTACACCTGGGTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017857.x-1624s1c1
Sequence:CCGGGAGAAGGTTGTAGGCATGGAACTCGAGTTCCATGCCTACAACCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017857.x-928s1c1
Sequence:CCGGGAGCTGTGGAAAGTGTTGGATCTCGAGATCCAACACTTTCCACAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017857.x-1786s1c1
Sequence:CCGGTCTTCCCACGAGTCTTCACATCTCGAGATGTGAAGACTCGTGGGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017857.x-2310s1c1
Sequence:CCGGCTTTCTAACTGGGATGTGGTACTCGAGTACCACATCCCAGTTAGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017857.x-1576s1c1
Sequence:CCGGTCTACACCATTCCCACCTCTTCTCGAGAAGAGGTGGGAATGGTGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017857
VALIDATED
SSH3 MISSION shRNA shRNA Plasmid DNA
slingshot protein phosphatase 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017857.3-2376s21c1
Sequence:CCGGGTCCAAGGGCTCAAGACTTTCCTCGAGGAAAGTCTTGAGCCCTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017857.3-1290s21c1
Sequence:CCGGAGCGCTTCACCTACCACAATGCTCGAGCATTGTGGTAGGTGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017857.3-2334s21c1
Sequence:CCGGCCTCACCTCCTACAGCCTTAACTCGAGTTAAGGCTGTAGGAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017857.3-684s21c1
Sequence:CCGGGTGACACCCAGGTGTACTTAGCTCGAGCTAAGTACACCTGGGTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017857.x-1624s1c1
Sequence:CCGGGAGAAGGTTGTAGGCATGGAACTCGAGTTCCATGCCTACAACCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017857.x-928s1c1
Sequence:CCGGGAGCTGTGGAAAGTGTTGGATCTCGAGATCCAACACTTTCCACAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017857.x-1786s1c1
Sequence:CCGGTCTTCCCACGAGTCTTCACATCTCGAGATGTGAAGACTCGTGGGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017857.x-2310s1c1
Sequence:CCGGCTTTCTAACTGGGATGTGGTACTCGAGTACCACATCCCAGTTAGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017857.x-1576s1c1
Sequence:CCGGTCTACACCATTCCCACCTCTTCTCGAGAAGAGGTGGGAATGGTGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017857
VALIDATED
SSH3 MISSION shRNA Lentiviral Transduction Particles
slingshot protein phosphatase 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017857.3-2376s21c1
Sequence:CCGGGTCCAAGGGCTCAAGACTTTCCTCGAGGAAAGTCTTGAGCCCTTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017857.3-1290s21c1
Sequence:CCGGAGCGCTTCACCTACCACAATGCTCGAGCATTGTGGTAGGTGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017857.3-2334s21c1
Sequence:CCGGCCTCACCTCCTACAGCCTTAACTCGAGTTAAGGCTGTAGGAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017857.3-684s21c1
Sequence:CCGGGTGACACCCAGGTGTACTTAGCTCGAGCTAAGTACACCTGGGTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017857.x-1624s1c1
Sequence:CCGGGAGAAGGTTGTAGGCATGGAACTCGAGTTCCATGCCTACAACCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017857.x-928s1c1
Sequence:CCGGGAGCTGTGGAAAGTGTTGGATCTCGAGATCCAACACTTTCCACAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017857.x-1786s1c1
Sequence:CCGGTCTTCCCACGAGTCTTCACATCTCGAGATGTGAAGACTCGTGGGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017857.x-2310s1c1
Sequence:CCGGCTTTCTAACTGGGATGTGGTACTCGAGTACCACATCCCAGTTAGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017857.x-1576s1c1
Sequence:CCGGTCTACACCATTCCCACCTCTTCTCGAGAAGAGGTGGGAATGGTGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198113
SSH3 MISSION shRNA Bacterial Glycerol Stock
slingshot protein phosphatase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198113.1-2092s1c1
Sequence:CCGGGCCTCAGATGAGTGGTCTTTACTCGAGTAAAGACCACTCATCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198113.1-1169s1c1
Sequence:CCGGCCGGGAGATTGACAACTTCTTCTCGAGAAGAAGTTGTCAATCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198113.1-1359s1c1
Sequence:CCGGGCCTATGCCATGAAACAGTATCTCGAGATACTGTTTCATGGCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198113.1-1552s1c1
Sequence:CCGGCGCCTGAAGTTTCTACACCATCTCGAGATGGTGTAGAAACTTCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198113.1-1197s1c1
Sequence:CCGGCGCTTCACCTATTACAATGTACTCGAGTACATTGTAATAGGTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198113
SSH3 MISSION shRNA shRNA Plasmid DNA
slingshot protein phosphatase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198113.1-2092s1c1
Sequence:CCGGGCCTCAGATGAGTGGTCTTTACTCGAGTAAAGACCACTCATCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198113.1-1169s1c1
Sequence:CCGGCCGGGAGATTGACAACTTCTTCTCGAGAAGAAGTTGTCAATCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198113.1-1359s1c1
Sequence:CCGGGCCTATGCCATGAAACAGTATCTCGAGATACTGTTTCATGGCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198113.1-1552s1c1
Sequence:CCGGCGCCTGAAGTTTCTACACCATCTCGAGATGGTGTAGAAACTTCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198113.1-1197s1c1
Sequence:CCGGCGCTTCACCTATTACAATGTACTCGAGTACATTGTAATAGGTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198113
SSH3 MISSION shRNA Lentiviral Transduction Particles
slingshot protein phosphatase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198113.1-2092s1c1
Sequence:CCGGGCCTCAGATGAGTGGTCTTTACTCGAGTAAAGACCACTCATCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198113.1-1169s1c1
Sequence:CCGGCCGGGAGATTGACAACTTCTTCTCGAGAAGAAGTTGTCAATCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198113.1-1359s1c1
Sequence:CCGGGCCTATGCCATGAAACAGTATCTCGAGATACTGTTTCATGGCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198113.1-1552s1c1
Sequence:CCGGCGCCTGAAGTTTCTACACCATCTCGAGATGGTGTAGAAACTTCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198113.1-1197s1c1
Sequence:CCGGCGCTTCACCTATTACAATGTACTCGAGTACATTGTAATAGGTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks