EMAIL THIS PAGE TO A FRIEND

SSMEM1

serine-rich single-pass membrane protein 1

Synonyms: C7orf45
UniProtKB ID: Q8WWF3
Gene ID:
Mouse(75647) serine-rich single-pass membrane protein 1
Rat(500068) serine-rich single-pass membrane protein 1
cow(615577) serine-rich single-pass membrane protein 1
domestic guinea pig(100721727) serine-rich single-pass membrane protein 1
naked mole-rat(101700460) serine-rich single-pass membrane protein 1
dog(608480) serine-rich single-pass membrane protein 1
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029373 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029373 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029373 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145268 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145268 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145268 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051551 MISSION® esiRNA esiRNA human C7orf45 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145268 Rosetta Predictions human pricing
NM_001109228 Rosetta Predictions rat pricing
NM_029373 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185923 predicted 1169
2 SASI_Hs01_00185924 predicted 539
3 SASI_Hs01_00185926 predicted 622
4 SASI_Hs01_00185928 predicted 280
5 SASI_Hs01_00185929 predicted 630
6 SASI_Hs02_00365138 predicted 392
7 SASI_Hs01_00185930 predicted 449
8 SASI_Hs01_00185931 predicted 681
9 SASI_Hs02_00365139 predicted 1165
10 SASI_Hs02_00365140 predicted 535
11 SASI_Hs01_00185925 predicted 240
12 SASI_Hs01_00185927 predicted 387
13 SASI_Hs01_00185932 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109228 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246344 predicted 755
2 SASI_Rn02_00246345 predicted 928
3 SASI_Rn02_00246346 predicted 712
4 SASI_Rn02_00246347 predicted 567
5 SASI_Rn02_00246348 predicted 733
6 SASI_Rn02_00246349 predicted 955
7 SASI_Rn02_00246350 predicted 616
8 SASI_Rn02_00246351 predicted 821
9 SASI_Rn02_00246352 predicted 457
10 SASI_Rn02_00246353 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029373 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043144 predicted 321
2 SASI_Mm01_00043145 predicted 461
3 SASI_Mm01_00043146 predicted 391
4 SASI_Mm02_00335250 predicted 430
5 SASI_Mm01_00043147 predicted 563
6 SASI_Mm01_00043150 predicted 583
7 SASI_Mm01_00043151 predicted 588
8 SASI_Mm01_00043152 predicted 445
9 SASI_Mm02_00335251 predicted 561
10 SASI_Mm01_00043153 predicted 494
11 SASI_Mm01_00043148 predicted 380
12 SASI_Mm01_00043149 predicted 376
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029373
SSMEM1 MISSION shRNA Bacterial Glycerol Stock
serine-rich single-pass membrane protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029373.1-154s1c1
Sequence:CCGGGATGACTCTTGCGGGACAATACTCGAGTATTGTCCCGCAAGAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029373.1-165s1c1
Sequence:CCGGCGGGACAATAGGAAGTTTCCTCTCGAGAGGAAACTTCCTATTGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029373.1-307s1c1
Sequence:CCGGGAAACTTCCTGTAAGCGACAACTCGAGTTGTCGCTTACAGGAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029373.1-187s1c1
Sequence:CCGGCTTTGGTACTTCATCATCATACTCGAGTATGATGATGAAGTACCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029373.1-170s1c1
Sequence:CCGGCAATAGGAAGTTTCCTGCTTTCTCGAGAAAGCAGGAAACTTCCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029373.1-201s1c1
Sequence:CCGGCATCATACTGATCCTCATGTTCTCGAGAACATGAGGATCAGTATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029373.3-470s1c1
Sequence:CCGGGAATCAGATCCAGCAAGATAGCTCGAGCTATCTTGCTGGATCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029373.3-374s1c1
Sequence:CCGGGAACCAAGTTTCCACAGTAACCTCGAGGTTACTGTGGAAACTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029373
SSMEM1 MISSION shRNA shRNA Plasmid DNA
serine-rich single-pass membrane protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029373.1-154s1c1
Sequence:CCGGGATGACTCTTGCGGGACAATACTCGAGTATTGTCCCGCAAGAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029373.1-165s1c1
Sequence:CCGGCGGGACAATAGGAAGTTTCCTCTCGAGAGGAAACTTCCTATTGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029373.1-307s1c1
Sequence:CCGGGAAACTTCCTGTAAGCGACAACTCGAGTTGTCGCTTACAGGAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029373.1-187s1c1
Sequence:CCGGCTTTGGTACTTCATCATCATACTCGAGTATGATGATGAAGTACCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029373.1-170s1c1
Sequence:CCGGCAATAGGAAGTTTCCTGCTTTCTCGAGAAAGCAGGAAACTTCCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029373.1-201s1c1
Sequence:CCGGCATCATACTGATCCTCATGTTCTCGAGAACATGAGGATCAGTATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029373.3-470s1c1
Sequence:CCGGGAATCAGATCCAGCAAGATAGCTCGAGCTATCTTGCTGGATCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029373.3-374s1c1
Sequence:CCGGGAACCAAGTTTCCACAGTAACCTCGAGGTTACTGTGGAAACTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029373
SSMEM1 MISSION shRNA Lentiviral Transduction Particles
serine-rich single-pass membrane protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029373.1-154s1c1
Sequence:CCGGGATGACTCTTGCGGGACAATACTCGAGTATTGTCCCGCAAGAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029373.1-165s1c1
Sequence:CCGGCGGGACAATAGGAAGTTTCCTCTCGAGAGGAAACTTCCTATTGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029373.1-307s1c1
Sequence:CCGGGAAACTTCCTGTAAGCGACAACTCGAGTTGTCGCTTACAGGAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029373.1-187s1c1
Sequence:CCGGCTTTGGTACTTCATCATCATACTCGAGTATGATGATGAAGTACCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029373.1-170s1c1
Sequence:CCGGCAATAGGAAGTTTCCTGCTTTCTCGAGAAAGCAGGAAACTTCCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029373.1-201s1c1
Sequence:CCGGCATCATACTGATCCTCATGTTCTCGAGAACATGAGGATCAGTATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029373.3-470s1c1
Sequence:CCGGGAATCAGATCCAGCAAGATAGCTCGAGCTATCTTGCTGGATCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029373.3-374s1c1
Sequence:CCGGGAACCAAGTTTCCACAGTAACCTCGAGGTTACTGTGGAAACTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145268
SSMEM1 MISSION shRNA Bacterial Glycerol Stock
serine-rich single-pass membrane protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145268.2-463s1c1
Sequence:CCGGGACAGTGATACTACGGAGTATCTCGAGATACTCCGTAGTATCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168689    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145268.2-1640s1c1
Sequence:CCGGGCCAAGGACTTACACATCAAACTCGAGTTTGATGTGTAAGTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145268.2-127s1c1
Sequence:CCGGGATGACTCTTGTGGAACCATACTCGAGTATGGTTCCACAAGAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145268.2-451s1c1
Sequence:CCGGCAGAACCAACATGACAGTGATCTCGAGATCACTGTCATGTTGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145268.3-1108s21c1
Sequence:CCGGTATGAATAAGAAAGCTCTTTGCTCGAGCAAAGAGCTTTCTTATTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145268.3-356s21c1
Sequence:CCGGACCAAAGCAGAACCAACTTACCTCGAGGTAAGTTGGTTCTGCTTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145268.3-108s21c1
Sequence:CCGGGCCATTCCAAATCAGGATTATCTCGAGATAATCCTGATTTGGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145268.3-741s21c1
Sequence:CCGGAGTTCCATATCTGACATTAACCTCGAGGTTAATGTCAGATATGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145268.3-225s21c1
Sequence:CCGGGTCTGGATGTCTGAGGATAAACTCGAGTTTATCCTCAGACATCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145268
SSMEM1 MISSION shRNA shRNA Plasmid DNA
serine-rich single-pass membrane protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145268.2-463s1c1
Sequence:CCGGGACAGTGATACTACGGAGTATCTCGAGATACTCCGTAGTATCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168689    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145268.2-1640s1c1
Sequence:CCGGGCCAAGGACTTACACATCAAACTCGAGTTTGATGTGTAAGTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145268.2-127s1c1
Sequence:CCGGGATGACTCTTGTGGAACCATACTCGAGTATGGTTCCACAAGAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145268.2-451s1c1
Sequence:CCGGCAGAACCAACATGACAGTGATCTCGAGATCACTGTCATGTTGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145268.3-1108s21c1
Sequence:CCGGTATGAATAAGAAAGCTCTTTGCTCGAGCAAAGAGCTTTCTTATTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145268.3-356s21c1
Sequence:CCGGACCAAAGCAGAACCAACTTACCTCGAGGTAAGTTGGTTCTGCTTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145268.3-108s21c1
Sequence:CCGGGCCATTCCAAATCAGGATTATCTCGAGATAATCCTGATTTGGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145268.3-741s21c1
Sequence:CCGGAGTTCCATATCTGACATTAACCTCGAGGTTAATGTCAGATATGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145268.3-225s21c1
Sequence:CCGGGTCTGGATGTCTGAGGATAAACTCGAGTTTATCCTCAGACATCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145268
SSMEM1 MISSION shRNA Lentiviral Transduction Particles
serine-rich single-pass membrane protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145268.2-463s1c1
Sequence:CCGGGACAGTGATACTACGGAGTATCTCGAGATACTCCGTAGTATCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168689    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145268.2-1640s1c1
Sequence:CCGGGCCAAGGACTTACACATCAAACTCGAGTTTGATGTGTAAGTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145268.2-127s1c1
Sequence:CCGGGATGACTCTTGTGGAACCATACTCGAGTATGGTTCCACAAGAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145268.2-451s1c1
Sequence:CCGGCAGAACCAACATGACAGTGATCTCGAGATCACTGTCATGTTGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145268.3-1108s21c1
Sequence:CCGGTATGAATAAGAAAGCTCTTTGCTCGAGCAAAGAGCTTTCTTATTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145268.3-356s21c1
Sequence:CCGGACCAAAGCAGAACCAACTTACCTCGAGGTAAGTTGGTTCTGCTTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145268.3-108s21c1
Sequence:CCGGGCCATTCCAAATCAGGATTATCTCGAGATAATCCTGATTTGGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145268.3-741s21c1
Sequence:CCGGAGTTCCATATCTGACATTAACCTCGAGGTTAATGTCAGATATGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145268.3-225s21c1
Sequence:CCGGGTCTGGATGTCTGAGGATAAACTCGAGTTTATCCTCAGACATCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks