EMAIL THIS PAGE TO A FRIEND

SSNA1

Sjogren syndrome nuclear autoantigen 1

Synonyms: N14 NA-14 NA14
UniProtKB ID: O43805, Q5VSG0, Q6FG70, Q9BVW8
Gene ID:
Mouse(68475) Sjogren's syndrome nuclear autoantigen 1
Rat(311802) Sjogren syndrome nuclear autoantigen 1
Zebrafish(561124) Sjogren syndrome nuclear autoantigen 1
dog(480666) Sjogren syndrome nuclear autoantigen 1
chicken(420480) Sjogren's syndrome nuclear autoantigen 1
domestic cat(101083043) Sjogren syndrome nuclear autoantigen 1
naked mole-rat(101719014) Sjogren syndrome nuclear autoantigen 1
domestic guinea pig(100730374) Sjogren syndrome nuclear autoantigen 1
cow(507840) Sjogren syndrome nuclear autoantigen 1
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003731 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003731 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003731 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023464 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023464 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023464 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003731 Rosetta Predictions human pricing
NM_001107820 Rosetta Predictions rat pricing
NM_023464 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117518 predicted 462
2 SASI_Hs01_00117519 predicted 314
3 SASI_Hs01_00117521 predicted 211
4 SASI_Hs01_00117522 predicted 581
5 SASI_Hs01_00117523 predicted 231
6 SASI_Hs01_00117524 predicted 227
7 SASI_Hs01_00117525 predicted 463
8 SASI_Hs01_00117527 predicted 232
9 SASI_Hs02_00336180 predicted 317
10 SASI_Hs02_00336181 predicted 507
11 SASI_Hs01_00117520 predicted 459
12 SASI_Hs01_00117526 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107820 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232595 predicted 212
2 SASI_Rn02_00232596 predicted 231
3 SASI_Rn02_00232597 predicted 199
4 SASI_Rn02_00232598 predicted 244
5 SASI_Rn02_00232599 predicted 212
6 SASI_Rn02_00232600 predicted 272
7 SASI_Rn02_00232601 predicted 247
8 SASI_Rn02_00232602 predicted 207
9 SASI_Rn02_00232603 predicted 223
10 SASI_Rn02_00232604 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100808 predicted 450
2 SASI_Mm01_00100809 predicted 417
3 SASI_Mm01_00100810 predicted 479
4 SASI_Mm01_00100811 predicted 220
5 SASI_Mm01_00100812 predicted 332
6 SASI_Mm01_00100813 predicted 602
7 SASI_Mm01_00100814 predicted 248
8 SASI_Mm01_00100815 predicted 463
9 SASI_Mm01_00100816 predicted 214
10 SASI_Mm01_00100817 predicted 373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003731
SSNA1 MISSION shRNA Bacterial Glycerol Stock
Sjogren syndrome nuclear autoantigen 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003731.2-179s21c1
Sequence:CCGGCATAGAGGAGCTGTGCCAGAACTCGAGTTCTGGCACAGCTCCTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003731.2-395s21c1
Sequence:CCGGGACTTTGCTCAGCGTTCTCAACTCGAGTTGAGAACGCTGAGCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003731.2-676s21c1
Sequence:CCGGTTCATGCTCACACAGGCTATGCTCGAGCATAGCCTGTGTGAGCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003731.2-301s21c1
Sequence:CCGGAGAACCTGGCACGCAAGATTGCTCGAGCAATCTTGCGTGCCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003731.2-540s21c1
Sequence:CCGGTGTGTGCTCAGAGCATCTTTGCTCGAGCAAAGATGCTCTGAGCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003731.2-163s21c1
Sequence:CCGGACGAGCTGGTCAAGTGCATAGCTCGAGCTATGCACTTGACCAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003731.2-152s21c1
Sequence:CCGGGAACTACAACAACGAGCTGGTCTCGAGACCAGCTCGTTGTTGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003731.2-410s21c1
Sequence:CCGGTCTCAAGAGGGAAGCTGGGAACTCGAGTTCCCAGCTTCCCTCTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003731.2-317s21c1
Sequence:CCGGGATTGCCTCTCGCAACGAGTTCTCGAGAACTCGTTGCGAGAGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180668    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003731.1-473s1c1
Sequence:CCGGGCATCTTTGTTCTTCACGGCACTCGAGTGCCGTGAAGAACAAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003731
SSNA1 MISSION shRNA shRNA Plasmid DNA
Sjogren syndrome nuclear autoantigen 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003731.2-179s21c1
Sequence:CCGGCATAGAGGAGCTGTGCCAGAACTCGAGTTCTGGCACAGCTCCTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003731.2-395s21c1
Sequence:CCGGGACTTTGCTCAGCGTTCTCAACTCGAGTTGAGAACGCTGAGCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003731.2-676s21c1
Sequence:CCGGTTCATGCTCACACAGGCTATGCTCGAGCATAGCCTGTGTGAGCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003731.2-301s21c1
Sequence:CCGGAGAACCTGGCACGCAAGATTGCTCGAGCAATCTTGCGTGCCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003731.2-540s21c1
Sequence:CCGGTGTGTGCTCAGAGCATCTTTGCTCGAGCAAAGATGCTCTGAGCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003731.2-163s21c1
Sequence:CCGGACGAGCTGGTCAAGTGCATAGCTCGAGCTATGCACTTGACCAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003731.2-152s21c1
Sequence:CCGGGAACTACAACAACGAGCTGGTCTCGAGACCAGCTCGTTGTTGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003731.2-410s21c1
Sequence:CCGGTCTCAAGAGGGAAGCTGGGAACTCGAGTTCCCAGCTTCCCTCTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003731.2-317s21c1
Sequence:CCGGGATTGCCTCTCGCAACGAGTTCTCGAGAACTCGTTGCGAGAGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180668    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003731.1-473s1c1
Sequence:CCGGGCATCTTTGTTCTTCACGGCACTCGAGTGCCGTGAAGAACAAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003731
SSNA1 MISSION shRNA Lentiviral Transduction Particles
Sjogren syndrome nuclear autoantigen 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003731.2-179s21c1
Sequence:CCGGCATAGAGGAGCTGTGCCAGAACTCGAGTTCTGGCACAGCTCCTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003731.2-395s21c1
Sequence:CCGGGACTTTGCTCAGCGTTCTCAACTCGAGTTGAGAACGCTGAGCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003731.2-676s21c1
Sequence:CCGGTTCATGCTCACACAGGCTATGCTCGAGCATAGCCTGTGTGAGCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003731.2-301s21c1
Sequence:CCGGAGAACCTGGCACGCAAGATTGCTCGAGCAATCTTGCGTGCCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003731.2-540s21c1
Sequence:CCGGTGTGTGCTCAGAGCATCTTTGCTCGAGCAAAGATGCTCTGAGCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003731.2-163s21c1
Sequence:CCGGACGAGCTGGTCAAGTGCATAGCTCGAGCTATGCACTTGACCAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003731.2-152s21c1
Sequence:CCGGGAACTACAACAACGAGCTGGTCTCGAGACCAGCTCGTTGTTGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003731.2-410s21c1
Sequence:CCGGTCTCAAGAGGGAAGCTGGGAACTCGAGTTCCCAGCTTCCCTCTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003731.2-317s21c1
Sequence:CCGGGATTGCCTCTCGCAACGAGTTCTCGAGAACTCGTTGCGAGAGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180668    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003731.1-473s1c1
Sequence:CCGGGCATCTTTGTTCTTCACGGCACTCGAGTGCCGTGAAGAACAAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023464
VALIDATED
SSNA1 MISSION shRNA Bacterial Glycerol Stock
Sjogren syndrome nuclear autoantigen 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023464.2-339s21c1
Sequence:CCGGGACTCTGCTTAGTGTACTCAACTCGAGTTGAGTACACTAAGCAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023464.2-123s21c1
Sequence:CCGGCATCGAGGAGTTGTGTCAGAACTCGAGTTCTGACACAACTCCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023464.2-364s21c1
Sequence:CCGGGAAGCTGGGAACCTGACTAAACTCGAGTTTAGTCAGGTTCCCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023464.2-468s21c1
Sequence:CCGGCCTCAACATGTCTGTCCTAAACTCGAGTTTAGGACAGACATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023464.1-462s1c1
Sequence:CCGGCCTCAACATGTCTGTCCTAAACTCGAGTTTAGGACAGACATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023464.1-117s1c1
Sequence:CCGGCATCGAGGAGTTGTGTCAGAACTCGAGTTCTGACACAACTCCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023464.1-333s1c1
Sequence:CCGGGACTCTGCTTAGTGTACTCAACTCGAGTTGAGTACACTAAGCAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023464.1-358s1c1
Sequence:CCGGGAAGCTGGGAACCTGACTAAACTCGAGTTTAGTCAGGTTCCCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023464.1-249s1c1
Sequence:CCGGGCGCAAGATCGCCTCTCGCAACTCGAGTTGCGAGAGGCGATCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023464
VALIDATED
SSNA1 MISSION shRNA shRNA Plasmid DNA
Sjogren syndrome nuclear autoantigen 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023464.2-339s21c1
Sequence:CCGGGACTCTGCTTAGTGTACTCAACTCGAGTTGAGTACACTAAGCAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023464.2-123s21c1
Sequence:CCGGCATCGAGGAGTTGTGTCAGAACTCGAGTTCTGACACAACTCCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023464.2-364s21c1
Sequence:CCGGGAAGCTGGGAACCTGACTAAACTCGAGTTTAGTCAGGTTCCCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023464.2-468s21c1
Sequence:CCGGCCTCAACATGTCTGTCCTAAACTCGAGTTTAGGACAGACATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023464.1-462s1c1
Sequence:CCGGCCTCAACATGTCTGTCCTAAACTCGAGTTTAGGACAGACATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023464.1-117s1c1
Sequence:CCGGCATCGAGGAGTTGTGTCAGAACTCGAGTTCTGACACAACTCCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023464.1-333s1c1
Sequence:CCGGGACTCTGCTTAGTGTACTCAACTCGAGTTGAGTACACTAAGCAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023464.1-358s1c1
Sequence:CCGGGAAGCTGGGAACCTGACTAAACTCGAGTTTAGTCAGGTTCCCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023464.1-249s1c1
Sequence:CCGGGCGCAAGATCGCCTCTCGCAACTCGAGTTGCGAGAGGCGATCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023464
VALIDATED
SSNA1 MISSION shRNA Lentiviral Transduction Particles
Sjogren syndrome nuclear autoantigen 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023464.2-339s21c1
Sequence:CCGGGACTCTGCTTAGTGTACTCAACTCGAGTTGAGTACACTAAGCAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023464.2-123s21c1
Sequence:CCGGCATCGAGGAGTTGTGTCAGAACTCGAGTTCTGACACAACTCCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023464.2-364s21c1
Sequence:CCGGGAAGCTGGGAACCTGACTAAACTCGAGTTTAGTCAGGTTCCCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023464.2-468s21c1
Sequence:CCGGCCTCAACATGTCTGTCCTAAACTCGAGTTTAGGACAGACATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023464.1-462s1c1
Sequence:CCGGCCTCAACATGTCTGTCCTAAACTCGAGTTTAGGACAGACATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023464.1-117s1c1
Sequence:CCGGCATCGAGGAGTTGTGTCAGAACTCGAGTTCTGACACAACTCCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023464.1-333s1c1
Sequence:CCGGGACTCTGCTTAGTGTACTCAACTCGAGTTGAGTACACTAAGCAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023464.1-358s1c1
Sequence:CCGGGAAGCTGGGAACCTGACTAAACTCGAGTTTAGTCAGGTTCCCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023464.1-249s1c1
Sequence:CCGGGCGCAAGATCGCCTCTCGCAACTCGAGTTGCGAGAGGCGATCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks