EMAIL THIS PAGE TO A FRIEND

SSPN

sarcospan

Synonyms: DAGA5 KRAG NSPN SPN1 SPN2
UniProtKB ID: Q14714, B3KS67
Gene ID:
Human(8082) Summary: This gene encodes a member of the dystrophin-glycoprotein complex (DGC). The DGC spans the sarcolemma and is comprised of dystrophin, syntrophin, alpha- and beta-dystroglycans and sarcoglycans. The DGC provides a structural link between the subsarcolemmal cytoskeleton and the extracellular matrix of muscle cells. Two alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Oct 2008]
Mouse(16651) sarcospan
Rat(500364) sarcospan
Zebrafish(641583) sarcospan (Kras oncogene-associated gene)
chicken(418211) sarcospan
dog(100684937) sarcospan
cow(613989) sarcospan (Kras oncogene-associated gene)
sheep(101112556) sarcospan
Domestic Rabbit(100008714) sarcospan (Kras oncogene-associated gene)
128 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010656 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010656 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010656 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005086 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005086 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005086 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005086 Rosetta Predictions human pricing
NM_001109255 Rosetta Predictions rat pricing
NM_010656 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338934 predicted 447
2 SASI_Hs01_00226759 predicted 366
3 SASI_Hs01_00226760 predicted 433
4 SASI_Hs01_00226762 predicted 369
5 SASI_Hs01_00226763 predicted 418
6 SASI_Hs01_00226764 predicted 371
7 SASI_Hs01_00226766 predicted 602
8 SASI_Hs01_00226767 predicted 553
9 SASI_Hs01_00226768 predicted 559
10 SASI_Hs02_00338935 predicted 536
11 SASI_Hs01_00226761 predicted 507
12 SASI_Hs01_00226765 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109255 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246614 predicted 197
2 SASI_Rn02_00246615 predicted 1106
3 SASI_Rn02_00246616 predicted 376
4 SASI_Rn02_00246617 predicted 464
5 SASI_Rn02_00246618 predicted 504
6 SASI_Rn02_00246619 predicted 496
7 SASI_Rn02_00246620 predicted 518
8 SASI_Rn02_00246621 predicted 397
9 SASI_Rn02_00246622 predicted 1169
10 SASI_Rn02_00246623 predicted 200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010656 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152425 predicted 495
2 SASI_Mm01_00152426 predicted 461
3 SASI_Mm01_00152428 predicted 361
4 SASI_Mm01_00152430 predicted 306
5 SASI_Mm01_00152431 predicted 502
6 SASI_Mm01_00152432 predicted 296
7 SASI_Mm01_00152433 predicted 390
8 SASI_Mm02_00319053 predicted 333
9 SASI_Mm02_00319054 predicted 420
10 SASI_Mm02_00319055 predicted 200
11 SASI_Mm01_00152424 predicted 1037
12 SASI_Mm01_00152427 predicted 1077
13 SASI_Mm01_00152429 predicted 1073
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010656
VALIDATED
SSPN MISSION shRNA Bacterial Glycerol Stock
sarcospan
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000112966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010656.1-580s1c1
Sequence:CCGGGCTTGCTTTGTGATGTGGAAACTCGAGTTTCCACATCACAAAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010656.1-189s1c1
Sequence:CCGGGCTAGTCAGAGATACTCCGTTCTCGAGAACGGAGTATCTCTGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010656.1-1035s1c1
Sequence:CCGGCGCGTGATTTAGAGAATCTAACTCGAGTTAGATTCTCTAAATCACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010656.1-470s1c1
Sequence:CCGGCCTTTGTTTACAGGGATGTGACTCGAGTCACATCCCTGTAAACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010656
VALIDATED
SSPN MISSION shRNA shRNA Plasmid DNA
sarcospan
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000112966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010656.1-580s1c1
Sequence:CCGGGCTTGCTTTGTGATGTGGAAACTCGAGTTTCCACATCACAAAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010656.1-189s1c1
Sequence:CCGGGCTAGTCAGAGATACTCCGTTCTCGAGAACGGAGTATCTCTGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010656.1-1035s1c1
Sequence:CCGGCGCGTGATTTAGAGAATCTAACTCGAGTTAGATTCTCTAAATCACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010656.1-470s1c1
Sequence:CCGGCCTTTGTTTACAGGGATGTGACTCGAGTCACATCCCTGTAAACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010656
VALIDATED
SSPN MISSION shRNA Lentiviral Transduction Particles
sarcospan
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000112966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010656.1-580s1c1
Sequence:CCGGGCTTGCTTTGTGATGTGGAAACTCGAGTTTCCACATCACAAAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010656.1-189s1c1
Sequence:CCGGGCTAGTCAGAGATACTCCGTTCTCGAGAACGGAGTATCTCTGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010656.1-1035s1c1
Sequence:CCGGCGCGTGATTTAGAGAATCTAACTCGAGTTAGATTCTCTAAATCACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010656.1-470s1c1
Sequence:CCGGCCTTTGTTTACAGGGATGTGACTCGAGTCACATCCCTGTAAACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005086
SSPN MISSION shRNA Bacterial Glycerol Stock
sarcospan
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005086.3-2271s1c1
Sequence:CCGGGCCTATTGATACACTTTACTACTCGAGTAGTAAAGTGTATCAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005086.3-721s1c1
Sequence:CCGGTGCTTTGTGATGTGGAAACATCTCGAGATGTTTCCACATCACAAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005086.3-420s1c1
Sequence:CCGGCGAACGGACATGTATTCAATTCTCGAGAATTGAATACATGTCCGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005086.3-718s1c1
Sequence:CCGGGCCTGCTTTGTGATGTGGAAACTCGAGTTTCCACATCACAAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005086.3-352s1c1
Sequence:CCGGGCTGGGATCATTGTCTGCTTACTCGAGTAAGCAGACAATGATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005086
SSPN MISSION shRNA shRNA Plasmid DNA
sarcospan
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005086.3-2271s1c1
Sequence:CCGGGCCTATTGATACACTTTACTACTCGAGTAGTAAAGTGTATCAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005086.3-721s1c1
Sequence:CCGGTGCTTTGTGATGTGGAAACATCTCGAGATGTTTCCACATCACAAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005086.3-420s1c1
Sequence:CCGGCGAACGGACATGTATTCAATTCTCGAGAATTGAATACATGTCCGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005086.3-718s1c1
Sequence:CCGGGCCTGCTTTGTGATGTGGAAACTCGAGTTTCCACATCACAAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005086.3-352s1c1
Sequence:CCGGGCTGGGATCATTGTCTGCTTACTCGAGTAAGCAGACAATGATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005086
SSPN MISSION shRNA Lentiviral Transduction Particles
sarcospan
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005086.3-2271s1c1
Sequence:CCGGGCCTATTGATACACTTTACTACTCGAGTAGTAAAGTGTATCAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005086.3-721s1c1
Sequence:CCGGTGCTTTGTGATGTGGAAACATCTCGAGATGTTTCCACATCACAAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005086.3-420s1c1
Sequence:CCGGCGAACGGACATGTATTCAATTCTCGAGAATTGAATACATGTCCGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005086.3-718s1c1
Sequence:CCGGGCCTGCTTTGTGATGTGGAAACTCGAGTTTCCACATCACAAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005086.3-352s1c1
Sequence:CCGGGCTGGGATCATTGTCTGCTTACTCGAGTAAGCAGACAATGATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks