EMAIL THIS PAGE TO A FRIEND

SSPO

SCO-spondin

UniProtKB ID: A2VEC9, Q76B61
Gene ID:
Mouse(243369) SCO-spondin
Rat(474348) SCO-spondin
naked mole-rat(101725610) SCO-spondin homolog (Bos taurus)
domestic guinea pig(100730916) SCO-spondin homolog (Bos taurus)
cow(282659) SCO-spondin homolog (Bos taurus)
sheep(101108910) SCO-spondin homolog (Bos taurus)
chicken(420367) SCO-spondin homolog (Bos taurus)
domestic cat(101092840) SCO-spondin homolog (Bos taurus)
dog(482788) SCO-spondin homolog (Bos taurus)
256 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0468 AQUA Peptide DGL(CM-Cys)VP[R] human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173428 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173428 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173428 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198455 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198455 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198455 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU175271 MISSION® esiRNA esiRNA targeting mouse Sspo mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198455 Rosetta Predictions human pricing
XM_379967 Rosetta Predictions human pricing
XM_930456 Rosetta Predictions human pricing
XM_934884 Rosetta Predictions human pricing
XM_934888 Rosetta Predictions human pricing
XM_934891 Rosetta Predictions human pricing
XM_934893 Rosetta Predictions human pricing
NM_001007016 Rosetta Predictions rat pricing
NM_173428 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371965 predicted 7846
2 SASI_Hs02_00371966 predicted 7280
3 SASI_Hs02_00371967 predicted 3669
4 SASI_Hs02_00371968 predicted 6047
5 SASI_Hs02_00371969 predicted 6745
6 SASI_Hs02_00371970 predicted 2320
7 SASI_Hs02_00371971 predicted 608
8 SASI_Hs02_00371972 predicted 8661
9 SASI_Hs02_00371973 predicted 3434
10 SASI_Hs02_00371974 predicted 7005
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_379967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263928 predicted 7813
2 SASI_Hs01_00263929 predicted 3678
3 SASI_Hs01_00263930 predicted 6066
4 SASI_Hs01_00263931 predicted 6763
5 SASI_Hs01_00263932 predicted 2326
6 SASI_Hs01_00263933 predicted 611
7 SASI_Hs01_00263934 predicted 1035
8 SASI_Hs01_00263935 predicted 8619
9 SASI_Hs01_00263936 predicted 3453
10 SASI_Hs01_00263937 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260527 predicted 1442
2 SASI_Hs01_00260528 predicted 4186
3 SASI_Hs01_00260529 predicted 4524
4 SASI_Hs01_00260530 predicted 1207
5 SASI_Hs01_00260531 predicted 4854
6 SASI_Hs01_00260532 predicted 3605
7 SASI_Hs01_00260533 predicted 1941
8 SASI_Hs01_00260534 predicted 3575
9 SASI_Hs01_00260535 predicted 3094
10 SASI_Hs01_00260536 predicted 4846
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934884 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291870 predicted 3225
2 SASI_Hs01_00291871 predicted 3091
3 SASI_Hs01_00291872 predicted 3149
4 SASI_Hs01_00291873 predicted 2730
5 SASI_Hs01_00291874 predicted 3138
6 SASI_Hs01_00291875 predicted 3166
7 SASI_Hs01_00291876 predicted 2741
8 SASI_Hs01_00291877 predicted 3048
9 SASI_Hs01_00291878 predicted 2711
10 SASI_Hs01_00291879 predicted 3117
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268486 predicted 1206
2 SASI_Hs01_00268487 predicted 354
3 SASI_Hs01_00268488 predicted 345
4 SASI_Hs01_00268489 predicted 1218
5 SASI_Hs01_00268490 predicted 606
6 SASI_Hs01_00268491 predicted 804
7 SASI_Hs01_00268492 predicted 855
8 SASI_Hs01_00268493 predicted 392
9 SASI_Hs01_00268494 predicted 656
10 SASI_Hs01_00268495 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263216 predicted 1163
2 SASI_Hs01_00263217 predicted 224
3 SASI_Hs01_00263218 predicted 216
4 SASI_Hs01_00263219 predicted 1421
5 SASI_Hs01_00263220 predicted 317
6 SASI_Hs01_00263221 predicted 736
7 SASI_Hs01_00263222 predicted 427
8 SASI_Hs01_00263223 predicted 1087
9 SASI_Hs01_00263224 predicted 1197
10 SASI_Hs01_00263225 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251318 predicted 2292
2 SASI_Hs01_00251319 predicted 2156
3 SASI_Hs01_00251320 predicted 2212
4 SASI_Hs01_00251321 predicted 1789
5 SASI_Hs01_00251322 predicted 2202
6 SASI_Hs01_00251323 predicted 2230
7 SASI_Hs01_00251324 predicted 1804
8 SASI_Hs01_00251325 predicted 2119
9 SASI_Hs01_00251326 predicted 1780
10 SASI_Hs01_00251327 predicted 2181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007016 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085006 predicted 3080
2 SASI_Rn01_00085007 predicted 3451
3 SASI_Rn01_00085008 predicted 6428
4 SASI_Rn01_00085009 predicted 3261
5 SASI_Rn01_00085010 predicted 3760
6 SASI_Rn02_00198610 predicted 14139
7 SASI_Rn01_00085013 predicted 2338
8 SASI_Rn01_00085014 predicted 5162
9 SASI_Rn01_00085015 predicted 7392
10 SASI_Rn02_00198611 predicted 14384
11 SASI_Rn01_00085011 predicted 8962
12 SASI_Rn01_00085012 predicted 14223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173428 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138279 predicted 14038
2 SASI_Mm01_00138280 predicted 3385
3 SASI_Mm01_00138281 predicted 12831
4 SASI_Mm01_00138282 predicted 8896
5 SASI_Mm01_00138283 predicted 10558
6 SASI_Mm01_00138284 predicted 13793
7 SASI_Mm01_00138285 predicted 1348
8 SASI_Mm01_00138286 predicted 11524
9 SASI_Mm01_00138287 predicted 8514
10 SASI_Mm01_00138288 predicted 2204
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173428
SSPO MISSION shRNA Bacterial Glycerol Stock
SCO-spondin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173428.1-6042s1c1
Sequence:CCGGCGACAATCTACAGTGGCACAACTCGAGTTGTGCCACTGTAGATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173428.1-5743s1c1
Sequence:CCGGGCCCATCTAGTCACCTATGTTCTCGAGAACATAGGTGACTAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173428.1-12268s1c1
Sequence:CCGGGCGATCTGCAAAGACACTGATCTCGAGATCAGTGTCTTTGCAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173428.1-125s1c1
Sequence:CCGGGCACCAGTTTGTACCATTATACTCGAGTATAATGGTACAAACTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173428.1-10466s1c1
Sequence:CCGGCCTGGGAGAAATGCAGTGTTTCTCGAGAAACACTGCATTTCTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173428
SSPO MISSION shRNA shRNA Plasmid DNA
SCO-spondin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173428.1-6042s1c1
Sequence:CCGGCGACAATCTACAGTGGCACAACTCGAGTTGTGCCACTGTAGATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173428.1-5743s1c1
Sequence:CCGGGCCCATCTAGTCACCTATGTTCTCGAGAACATAGGTGACTAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173428.1-12268s1c1
Sequence:CCGGGCGATCTGCAAAGACACTGATCTCGAGATCAGTGTCTTTGCAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173428.1-125s1c1
Sequence:CCGGGCACCAGTTTGTACCATTATACTCGAGTATAATGGTACAAACTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173428.1-10466s1c1
Sequence:CCGGCCTGGGAGAAATGCAGTGTTTCTCGAGAAACACTGCATTTCTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173428
SSPO MISSION shRNA Lentiviral Transduction Particles
SCO-spondin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173428.1-6042s1c1
Sequence:CCGGCGACAATCTACAGTGGCACAACTCGAGTTGTGCCACTGTAGATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173428.1-5743s1c1
Sequence:CCGGGCCCATCTAGTCACCTATGTTCTCGAGAACATAGGTGACTAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173428.1-12268s1c1
Sequence:CCGGGCGATCTGCAAAGACACTGATCTCGAGATCAGTGTCTTTGCAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173428.1-125s1c1
Sequence:CCGGGCACCAGTTTGTACCATTATACTCGAGTATAATGGTACAAACTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173428.1-10466s1c1
Sequence:CCGGCCTGGGAGAAATGCAGTGTTTCTCGAGAAACACTGCATTTCTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198455
SSPO MISSION shRNA Bacterial Glycerol Stock
SCO-spondin
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000436531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198455.2-12723s21c1
Sequence:CCGGGGGTGTGATCTGCGAAGATACCTCGAGGTATCTTCGCAGATCACACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198455.2-3627s21c1
Sequence:CCGGGCAGCCGCTCTTCACATTATGCTCGAGCATAATGTGAAGAGCGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198455
SSPO MISSION shRNA shRNA Plasmid DNA
SCO-spondin
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000436531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198455.2-12723s21c1
Sequence:CCGGGGGTGTGATCTGCGAAGATACCTCGAGGTATCTTCGCAGATCACACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198455.2-3627s21c1
Sequence:CCGGGCAGCCGCTCTTCACATTATGCTCGAGCATAATGTGAAGAGCGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198455
SSPO MISSION shRNA Lentiviral Transduction Particles
SCO-spondin
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000436531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198455.2-12723s21c1
Sequence:CCGGGGGTGTGATCTGCGAAGATACCTCGAGGTATCTTCGCAGATCACACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198455.2-3627s21c1
Sequence:CCGGGCAGCCGCTCTTCACATTATGCTCGAGCATAATGTGAAGAGCGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks