EMAIL THIS PAGE TO A FRIEND

SSR1

signal sequence receptor, alpha

Synonyms: TRAPA
Gene ID:
Human(6745) Summary: The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR consists of 2 subunits, a 34-kD glycoprotein encoded by this gene and a 22-kD glycoprotein. This gene generates several mRNA species as a result of complex alternative polyadenylation. This gene is unusual in that it utilizes arrays of polyA signal sequences that are mostly non-canonical. [provided by RefSeq, Jul 2008]
Mouse(107513) signal sequence receptor, alpha
Rat(361233) signal sequence receptor, alpha
Zebrafish(373100) signal sequence receptor, alpha
dog(403951) signal sequence receptor, alpha
domestic cat(101099638) signal sequence receptor, alpha
chicken(420871) signal sequence receptor, alpha
cow(529312) signal sequence receptor, alpha
domestic guinea pig(100729627) signal sequence receptor, alpha
naked mole-rat(101711029) signal sequence receptor, alpha
Domestic Rabbit(100009532) signal sequence receptor, alpha
163 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003144 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003144 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003144 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025965 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025965 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025965 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132121 MISSION® esiRNA esiRNA human SSR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003144 Rosetta Predictions human pricing
NM_001008891 Rosetta Predictions rat pricing
NM_025965 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003144 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117598 predicted 282
2 SASI_Hs01_00117599 predicted 469
3 SASI_Hs01_00117601 predicted 426
4 SASI_Hs01_00117602 predicted 488
5 SASI_Hs01_00117603 predicted 879
6 SASI_Hs02_00335147 predicted 1016
7 SASI_Hs01_00117604 predicted 789
8 SASI_Hs01_00117605 predicted 301
9 SASI_Hs01_00117606 predicted 689
10 SASI_Hs02_00335148 predicted 907
11 SASI_Hs01_00117600 predicted 894
12 SASI_Hs01_00117607 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008891 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035079 predicted 735
2 SASI_Rn01_00035080 predicted 672
3 SASI_Rn01_00035081 predicted 822
4 SASI_Rn01_00035082 predicted 597
5 SASI_Rn01_00035083 predicted 771
6 SASI_Rn01_00035084 predicted 567
7 SASI_Rn01_00035085 predicted 837
8 SASI_Rn01_00035086 predicted 711
9 SASI_Rn01_00035087 predicted 761
10 SASI_Rn01_00035088 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025965 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097450 predicted 637
2 SASI_Mm01_00097451 predicted 839
3 SASI_Mm01_00097453 predicted 460
4 SASI_Mm01_00097454 predicted 354
5 SASI_Mm01_00097455 predicted 230
6 SASI_Mm02_00329382 predicted 864
7 SASI_Mm01_00097456 predicted 673
8 SASI_Mm01_00097457 predicted 223
9 SASI_Mm01_00097458 predicted 884
10 SASI_Mm01_00097459 predicted 892
11 SASI_Mm01_00097452 predicted 787
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003144
VALIDATED
SSR1 MISSION shRNA Bacterial Glycerol Stock
signal sequence receptor, alpha
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003144.3-957s21c1
Sequence:CCGGCCTCAGGAAACATTGAATCAACTCGAGTTGATTCAATGTTTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_003144.3-369s21c1
Sequence:CCGGCCCACAGATTTGGTAGAAGATCTCGAGATCTTCTACCAAATCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003144.3-429s21c1
Sequence:CCGGCCGAGTGCAGATACAACTATACTCGAGTATAGTTGTATCTGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003144.3-750s21c1
Sequence:CCGGGCAGTCTTCAATCAAACAGTTCTCGAGAACTGTTTGATTGAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003144.3-859s21c1
Sequence:CCGGGCCTTCATCAACTCCTAGAATCTCGAGATTCTAGGAGTTGATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003144.2-880s1c1
Sequence:CCGGCCTCAGGAAACATTGAATCAACTCGAGTTGATTCAATGTTTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003144.2-292s1c1
Sequence:CCGGCCCACAGATTTGGTAGAAGATCTCGAGATCTTCTACCAAATCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003144.2-352s1c1
Sequence:CCGGCCGAGTGCAGATACAACTATACTCGAGTATAGTTGTATCTGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003144.2-782s1c1
Sequence:CCGGGCCTTCATCAACTCCTAGAATCTCGAGATTCTAGGAGTTGATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003144.2-673s1c1
Sequence:CCGGGCAGTCTTCAATCAAACAGTTCTCGAGAACTGTTTGATTGAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003144
VALIDATED
SSR1 MISSION shRNA shRNA Plasmid DNA
signal sequence receptor, alpha
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003144.3-957s21c1
Sequence:CCGGCCTCAGGAAACATTGAATCAACTCGAGTTGATTCAATGTTTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_003144.3-369s21c1
Sequence:CCGGCCCACAGATTTGGTAGAAGATCTCGAGATCTTCTACCAAATCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003144.3-429s21c1
Sequence:CCGGCCGAGTGCAGATACAACTATACTCGAGTATAGTTGTATCTGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003144.3-750s21c1
Sequence:CCGGGCAGTCTTCAATCAAACAGTTCTCGAGAACTGTTTGATTGAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003144.3-859s21c1
Sequence:CCGGGCCTTCATCAACTCCTAGAATCTCGAGATTCTAGGAGTTGATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003144.2-880s1c1
Sequence:CCGGCCTCAGGAAACATTGAATCAACTCGAGTTGATTCAATGTTTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003144.2-292s1c1
Sequence:CCGGCCCACAGATTTGGTAGAAGATCTCGAGATCTTCTACCAAATCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003144.2-352s1c1
Sequence:CCGGCCGAGTGCAGATACAACTATACTCGAGTATAGTTGTATCTGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003144.2-782s1c1
Sequence:CCGGGCCTTCATCAACTCCTAGAATCTCGAGATTCTAGGAGTTGATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003144.2-673s1c1
Sequence:CCGGGCAGTCTTCAATCAAACAGTTCTCGAGAACTGTTTGATTGAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003144
VALIDATED
SSR1 MISSION shRNA Lentiviral Transduction Particles
signal sequence receptor, alpha
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003144.3-957s21c1
Sequence:CCGGCCTCAGGAAACATTGAATCAACTCGAGTTGATTCAATGTTTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_003144.3-369s21c1
Sequence:CCGGCCCACAGATTTGGTAGAAGATCTCGAGATCTTCTACCAAATCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003144.3-429s21c1
Sequence:CCGGCCGAGTGCAGATACAACTATACTCGAGTATAGTTGTATCTGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003144.3-750s21c1
Sequence:CCGGGCAGTCTTCAATCAAACAGTTCTCGAGAACTGTTTGATTGAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003144.3-859s21c1
Sequence:CCGGGCCTTCATCAACTCCTAGAATCTCGAGATTCTAGGAGTTGATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003144.2-880s1c1
Sequence:CCGGCCTCAGGAAACATTGAATCAACTCGAGTTGATTCAATGTTTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003144.2-292s1c1
Sequence:CCGGCCCACAGATTTGGTAGAAGATCTCGAGATCTTCTACCAAATCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003144.2-352s1c1
Sequence:CCGGCCGAGTGCAGATACAACTATACTCGAGTATAGTTGTATCTGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003144.2-782s1c1
Sequence:CCGGGCCTTCATCAACTCCTAGAATCTCGAGATTCTAGGAGTTGATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003144.2-673s1c1
Sequence:CCGGGCAGTCTTCAATCAAACAGTTCTCGAGAACTGTTTGATTGAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025965
VALIDATED
SSR1 MISSION shRNA Bacterial Glycerol Stock
signal sequence receptor, alpha
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025965.2-771s1c1
Sequence:CCGGCCTGGAATCTAGAAAGCGCAACTCGAGTTGCGCTTTCTAGATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025965.2-615s1c1
Sequence:CCGGCTACAAAGATTTGAACGGCAACTCGAGTTGCCGTTCAAATCTTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025965.2-2352s1c1
Sequence:CCGGGCCAATAATGATTGAAGGTTTCTCGAGAAACCTTCAATCATTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025965.2-334s1c1
Sequence:CCGGGCAGACACAACTATTCTGTTTCTCGAGAAACAGAATAGTTGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025965.2-594s1c1
Sequence:CCGGTGGTCTGGTTATCAATCTGAACTCGAGTTCAGATTGATAACCAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025965
VALIDATED
SSR1 MISSION shRNA shRNA Plasmid DNA
signal sequence receptor, alpha
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025965.2-771s1c1
Sequence:CCGGCCTGGAATCTAGAAAGCGCAACTCGAGTTGCGCTTTCTAGATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025965.2-615s1c1
Sequence:CCGGCTACAAAGATTTGAACGGCAACTCGAGTTGCCGTTCAAATCTTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025965.2-2352s1c1
Sequence:CCGGGCCAATAATGATTGAAGGTTTCTCGAGAAACCTTCAATCATTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025965.2-334s1c1
Sequence:CCGGGCAGACACAACTATTCTGTTTCTCGAGAAACAGAATAGTTGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025965.2-594s1c1
Sequence:CCGGTGGTCTGGTTATCAATCTGAACTCGAGTTCAGATTGATAACCAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025965
VALIDATED
SSR1 MISSION shRNA Lentiviral Transduction Particles
signal sequence receptor, alpha
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025965.2-771s1c1
Sequence:CCGGCCTGGAATCTAGAAAGCGCAACTCGAGTTGCGCTTTCTAGATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025965.2-615s1c1
Sequence:CCGGCTACAAAGATTTGAACGGCAACTCGAGTTGCCGTTCAAATCTTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025965.2-2352s1c1
Sequence:CCGGGCCAATAATGATTGAAGGTTTCTCGAGAAACCTTCAATCATTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025965.2-334s1c1
Sequence:CCGGGCAGACACAACTATTCTGTTTCTCGAGAAACAGAATAGTTGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025965.2-594s1c1
Sequence:CCGGTGGTCTGGTTATCAATCTGAACTCGAGTTCAGATTGATAACCAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks