EMAIL THIS PAGE TO A FRIEND

SSR2

signal sequence receptor, beta (translocon-associated protein beta)

Synonyms: TLAP TRAP-BETA TRAPB
Gene ID:
Human(6746) Summary: The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR consists of 2 subunits, a 34-kD glycoprotein (alpha-SSR or SSR1) and a 22-kD glycoprotein (beta-SSR or SSR2). The human beta-signal sequence receptor gene (SSR2) maps to chromosome bands 1q21-q23. [provided by RefSeq, Jul 2008]
Mouse(66256) signal sequence receptor, beta
Rat(295235) signal sequence receptor, beta
Zebrafish(83414) signal sequence receptor, beta
dog(403950) signal sequence receptor, beta (translocon-associated protein beta)
domestic cat(101085095) signal sequence receptor, beta (translocon-associated protein beta)
chicken(425656) signal sequence receptor, beta (translocon-associated protein beta)
naked mole-rat(101702420) signal sequence receptor, beta (translocon-associated protein beta)
domestic guinea pig(100719900) signal sequence receptor, beta (translocon-associated protein beta)
cow(506530) signal sequence receptor, beta (translocon-associated protein beta)
sheep(101122235) signal sequence receptor, beta (translocon-associated protein beta)
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025448 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025448 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025448 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003145 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003145 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003145 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003145 Rosetta Predictions human pricing
NM_001106442 Rosetta Predictions rat pricing
NM_025448 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003145 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245082 predicted 768
2 SASI_Hs01_00245083 predicted 568
3 SASI_Hs01_00245084 predicted 591
4 SASI_Hs02_00335149 predicted 211
5 SASI_Hs02_00335150 predicted 819
6 SASI_Hs01_00245086 predicted 728
7 SASI_Hs01_00245087 predicted 231
8 SASI_Hs01_00245088 predicted 280
9 SASI_Hs01_00245089 predicted 351
10 SASI_Hs01_00245090 predicted 702
11 SASI_Hs01_00245085 predicted 407
12 SASI_Hs01_00245091 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106442 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218998 predicted 374
2 SASI_Rn02_00218999 predicted 314
3 SASI_Rn02_00219000 predicted 358
4 SASI_Rn02_00219001 predicted 228
5 SASI_Rn02_00219002 predicted 319
6 SASI_Rn02_00219003 predicted 316
7 SASI_Rn02_00219004 predicted 596
8 SASI_Rn02_00219005 predicted 362
9 SASI_Rn02_00219006 predicted 818
10 SASI_Rn02_00219007 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025448 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062245 predicted 217
2 SASI_Mm01_00062246 predicted 551
3 SASI_Mm01_00062247 predicted 666
4 SASI_Mm01_00062248 predicted 474
5 SASI_Mm01_00062249 predicted 466
6 SASI_Mm01_00062250 predicted 280
7 SASI_Mm01_00062251 predicted 718
8 SASI_Mm01_00062252 predicted 231
9 SASI_Mm01_00062253 predicted 456
10 SASI_Mm01_00062254 predicted 388
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025448
VALIDATED
SSR2 MISSION shRNA Bacterial Glycerol Stock
signal sequence receptor, beta (translocon-associated protein beta)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025448.2-930s1c1
Sequence:CCGGCCGTTGTCACTGAAGCCATATCTCGAGATATGGCTTCAGTGACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025448.2-333s1c1
Sequence:CCGGCCTGCAGTATAACATCTACAACTCGAGTTGTAGATGTTATACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025448.2-426s1c1
Sequence:CCGGCTCCGGTATGCTCAATGTCAACTCGAGTTGACATTGAGCATACCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025448.2-365s1c1
Sequence:CCGGGCGCTGCATTAGATGTGGAATCTCGAGATTCCACATCTAATGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025448.2-368s1c1
Sequence:CCGGCTGCATTAGATGTGGAATTATCTCGAGATAATTCCACATCTAATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025448.3-618s21c1
Sequence:CCGGCGGGAGTTTGACAGGAGATTCCTCGAGGAATCTCCTGTCAAACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025448.3-929s21c1
Sequence:CCGGCCGTTGTCACTGAAGCCATATCTCGAGATATGGCTTCAGTGACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025448.3-487s21c1
Sequence:CCGGTTGTCCTGCGTCCTCTCAAAGCTCGAGCTTTGAGAGGACGCAGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025448.3-556s21c1
Sequence:CCGGAGGATGGACCTGTTGTGATTGCTCGAGCAATCACAACAGGTCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025448.3-520s21c1
Sequence:CCGGACTTCACTTCTGCCACGATTACTCGAGTAATCGTGGCAGAAGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025448
VALIDATED
SSR2 MISSION shRNA shRNA Plasmid DNA
signal sequence receptor, beta (translocon-associated protein beta)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025448.2-930s1c1
Sequence:CCGGCCGTTGTCACTGAAGCCATATCTCGAGATATGGCTTCAGTGACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025448.2-333s1c1
Sequence:CCGGCCTGCAGTATAACATCTACAACTCGAGTTGTAGATGTTATACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025448.2-426s1c1
Sequence:CCGGCTCCGGTATGCTCAATGTCAACTCGAGTTGACATTGAGCATACCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025448.2-365s1c1
Sequence:CCGGGCGCTGCATTAGATGTGGAATCTCGAGATTCCACATCTAATGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025448.2-368s1c1
Sequence:CCGGCTGCATTAGATGTGGAATTATCTCGAGATAATTCCACATCTAATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025448.3-618s21c1
Sequence:CCGGCGGGAGTTTGACAGGAGATTCCTCGAGGAATCTCCTGTCAAACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025448.3-929s21c1
Sequence:CCGGCCGTTGTCACTGAAGCCATATCTCGAGATATGGCTTCAGTGACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025448.3-487s21c1
Sequence:CCGGTTGTCCTGCGTCCTCTCAAAGCTCGAGCTTTGAGAGGACGCAGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025448.3-556s21c1
Sequence:CCGGAGGATGGACCTGTTGTGATTGCTCGAGCAATCACAACAGGTCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025448.3-520s21c1
Sequence:CCGGACTTCACTTCTGCCACGATTACTCGAGTAATCGTGGCAGAAGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025448
VALIDATED
SSR2 MISSION shRNA Lentiviral Transduction Particles
signal sequence receptor, beta (translocon-associated protein beta)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025448.2-930s1c1
Sequence:CCGGCCGTTGTCACTGAAGCCATATCTCGAGATATGGCTTCAGTGACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025448.2-333s1c1
Sequence:CCGGCCTGCAGTATAACATCTACAACTCGAGTTGTAGATGTTATACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025448.2-426s1c1
Sequence:CCGGCTCCGGTATGCTCAATGTCAACTCGAGTTGACATTGAGCATACCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025448.2-365s1c1
Sequence:CCGGGCGCTGCATTAGATGTGGAATCTCGAGATTCCACATCTAATGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025448.2-368s1c1
Sequence:CCGGCTGCATTAGATGTGGAATTATCTCGAGATAATTCCACATCTAATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025448.3-618s21c1
Sequence:CCGGCGGGAGTTTGACAGGAGATTCCTCGAGGAATCTCCTGTCAAACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025448.3-929s21c1
Sequence:CCGGCCGTTGTCACTGAAGCCATATCTCGAGATATGGCTTCAGTGACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025448.3-487s21c1
Sequence:CCGGTTGTCCTGCGTCCTCTCAAAGCTCGAGCTTTGAGAGGACGCAGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025448.3-556s21c1
Sequence:CCGGAGGATGGACCTGTTGTGATTGCTCGAGCAATCACAACAGGTCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025448.3-520s21c1
Sequence:CCGGACTTCACTTCTGCCACGATTACTCGAGTAATCGTGGCAGAAGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003145
VALIDATED
SSR2 MISSION shRNA Bacterial Glycerol Stock
signal sequence receptor, beta (translocon-associated protein beta)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003145.2-207s1c1
Sequence:CCGGGCTGCATTAGACGTGGAACTACTCGAGTAGTTCCACGTCTAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003145.2-243s1c1
Sequence:CCGGCCTCCAGAAGACTTTGGCATTCTCGAGAATGCCAAAGTCTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003145.2-458s1c1
Sequence:CCGGGCGGGAGTTTGACAGGCGATTCTCGAGAATCGCCTGTCAAACTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003145.2-567s1c1
Sequence:CCGGAGGAAATATGACACTCCCAAACTCGAGTTTGGGAGTGTCATATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003145.2-338s1c1
Sequence:CCGGCCCTCTCAAGGCTGGTTATTTCTCGAGAAATAACCAGCCTTGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003145.3-273s21c1
Sequence:CCGGCCTCCAGAAGACTTTGGCATTCTCGAGAATGCCAAAGTCTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003145.3-391s21c1
Sequence:CCGGACTTCACCTCGGCAACAATTACTCGAGTAATTGTTGCCGAGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003145.3-702s21c1
Sequence:CCGGAGACTCCAAAGGGTATCTTAACTCGAGTTAAGATACCCTTTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003145.3-368s21c1
Sequence:CCGGCCCTCTCAAGGCTGGTTATTTCTCGAGAAATAACCAGCCTTGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003145.3-488s21c1
Sequence:CCGGGCGGGAGTTTGACAGGCGATTCTCGAGAATCGCCTGTCAAACTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003145
VALIDATED
SSR2 MISSION shRNA shRNA Plasmid DNA
signal sequence receptor, beta (translocon-associated protein beta)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003145.2-207s1c1
Sequence:CCGGGCTGCATTAGACGTGGAACTACTCGAGTAGTTCCACGTCTAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003145.2-243s1c1
Sequence:CCGGCCTCCAGAAGACTTTGGCATTCTCGAGAATGCCAAAGTCTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003145.2-458s1c1
Sequence:CCGGGCGGGAGTTTGACAGGCGATTCTCGAGAATCGCCTGTCAAACTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003145.2-567s1c1
Sequence:CCGGAGGAAATATGACACTCCCAAACTCGAGTTTGGGAGTGTCATATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003145.2-338s1c1
Sequence:CCGGCCCTCTCAAGGCTGGTTATTTCTCGAGAAATAACCAGCCTTGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003145.3-273s21c1
Sequence:CCGGCCTCCAGAAGACTTTGGCATTCTCGAGAATGCCAAAGTCTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003145.3-391s21c1
Sequence:CCGGACTTCACCTCGGCAACAATTACTCGAGTAATTGTTGCCGAGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003145.3-702s21c1
Sequence:CCGGAGACTCCAAAGGGTATCTTAACTCGAGTTAAGATACCCTTTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003145.3-368s21c1
Sequence:CCGGCCCTCTCAAGGCTGGTTATTTCTCGAGAAATAACCAGCCTTGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003145.3-488s21c1
Sequence:CCGGGCGGGAGTTTGACAGGCGATTCTCGAGAATCGCCTGTCAAACTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003145
VALIDATED
SSR2 MISSION shRNA Lentiviral Transduction Particles
signal sequence receptor, beta (translocon-associated protein beta)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003145.2-207s1c1
Sequence:CCGGGCTGCATTAGACGTGGAACTACTCGAGTAGTTCCACGTCTAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003145.2-243s1c1
Sequence:CCGGCCTCCAGAAGACTTTGGCATTCTCGAGAATGCCAAAGTCTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003145.2-458s1c1
Sequence:CCGGGCGGGAGTTTGACAGGCGATTCTCGAGAATCGCCTGTCAAACTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003145.2-567s1c1
Sequence:CCGGAGGAAATATGACACTCCCAAACTCGAGTTTGGGAGTGTCATATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003145.2-338s1c1
Sequence:CCGGCCCTCTCAAGGCTGGTTATTTCTCGAGAAATAACCAGCCTTGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003145.3-273s21c1
Sequence:CCGGCCTCCAGAAGACTTTGGCATTCTCGAGAATGCCAAAGTCTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003145.3-391s21c1
Sequence:CCGGACTTCACCTCGGCAACAATTACTCGAGTAATTGTTGCCGAGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003145.3-702s21c1
Sequence:CCGGAGACTCCAAAGGGTATCTTAACTCGAGTTAAGATACCCTTTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003145.3-368s21c1
Sequence:CCGGCCCTCTCAAGGCTGGTTATTTCTCGAGAAATAACCAGCCTTGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003145.3-488s21c1
Sequence:CCGGGCGGGAGTTTGACAGGCGATTCTCGAGAATCGCCTGTCAAACTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks