EMAIL THIS PAGE TO A FRIEND

SSR3

signal sequence receptor, gamma (translocon-associated protein gamma)

Synonyms: TRAPG
UniProtKB ID: Q9UNL2, B2R7D0, D3DNK5, Q549M4
Gene ID:
Human(6747) Summary: The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR is comprised of four membrane proteins/subunits: alpha, beta, gamma, and delta. The first two are glycosylated subunits and the latter two are non-glycosylated subunits. This gene encodes the gamma subunit, which is predicted to span the membrane four times. [provided by RefSeq, Aug 2010]
Mouse(67437) signal sequence receptor, gamma
Rat(81784) signal sequence receptor, gamma
cow(767980) signal sequence receptor, gamma (translocon-associated protein gamma)
sheep(101110723) signal sequence receptor, gamma (translocon-associated protein gamma)
domestic guinea pig(100726044) signal sequence receptor, gamma (translocon-associated protein gamma)
naked mole-rat(101721516) signal sequence receptor, gamma (translocon-associated protein gamma)
Zebrafish(337190) signal sequence receptor, gamma
dog(477124) signal sequence receptor, gamma (translocon-associated protein gamma)
domestic cat(101085915) signal sequence receptor, gamma (translocon-associated protein gamma)
chicken(425027) signal sequence receptor, gamma (translocon-associated protein gamma)
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007107 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007107 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007107 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026155 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026155 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026155 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007107 Rosetta Predictions human pricing
NM_031120 Rosetta Predictions rat pricing
NM_026155 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046728 predicted 261
2 SASI_Hs01_00046729 predicted 207
3 SASI_Hs01_00046730 predicted 239
4 SASI_Hs01_00046731 predicted 791
5 SASI_Hs01_00046732 predicted 816
6 SASI_Hs01_00046735 predicted 258
7 SASI_Hs01_00046736 predicted 278
8 SASI_Hs01_00046737 predicted 557
9 SASI_Hs02_00342946 predicted 856
10 SASI_Hs02_00342947 predicted 199
11 SASI_Hs01_00046733 predicted 782
12 SASI_Hs01_00046734 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031120 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091967 predicted 507
2 SASI_Rn01_00091968 predicted 786
3 SASI_Rn01_00091969 predicted 324
4 SASI_Rn01_00091970 predicted 744
5 SASI_Rn01_00091971 predicted 225
6 SASI_Rn01_00091972 predicted 754
7 SASI_Rn02_00264427 predicted 221
8 SASI_Rn01_00091973 predicted 412
9 SASI_Rn01_00091974 predicted 389
10 SASI_Rn01_00091975 predicted 520
11 SASI_Rn01_00091976 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026155 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140448 predicted 750
2 SASI_Mm01_00140449 predicted 758
3 SASI_Mm01_00140450 predicted 411
4 SASI_Mm01_00140451 predicted 468
5 SASI_Mm01_00140452 predicted 747
6 SASI_Mm01_00140453 predicted 811
7 SASI_Mm01_00140454 predicted 714
8 SASI_Mm01_00140455 predicted 740
9 SASI_Mm01_00140456 predicted 459
10 SASI_Mm02_00329771 predicted 613
11 SASI_Mm01_00140447 predicted 722
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007107
VALIDATED
SSR3 MISSION shRNA Bacterial Glycerol Stock
signal sequence receptor, gamma (translocon-associated protein gamma)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007107.2-488s21c1
Sequence:CCGGTGTTCCTGGTCGTGGTCATTGCTCGAGCAATGACCACGACCAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_007107.2-107s21c1
Sequence:CCGGTGCAGGATTTCAGCCGCAATCCTCGAGGATTGCGGCTGAAATCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007107.2-818s21c1
Sequence:CCGGAGAGTACTAGGACGTTTATTACTCGAGTAATAAACGTCCTAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007107.2-252s21c1
Sequence:CCGGGACCCTAGTAAGCACATATTTCTCGAGAAATATGTGCTTACTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_007107.2-594s21c1
Sequence:CCGGCCTGTCTACTGGCTCCAAATACTCGAGTATTTGGAGCCAGTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007107.2-594s1c1
Sequence:CCGGCCTGTCTACTGGCTCCAAATACTCGAGTATTTGGAGCCAGTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007107.2-252s1c1
Sequence:CCGGGACCCTAGTAAGCACATATTTCTCGAGAAATATGTGCTTACTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007107.2-185s1c1
Sequence:CCGGCCATCTGGTTATACTGGCGAACTCGAGTTCGCCAGTATAACCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_007107.2-547s1c1
Sequence:CCGGGTGAACTACATATTGTCCATACTCGAGTATGGACAATATGTAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007107.2-408s1c1
Sequence:CCGGAGATGAAAGAATCTTGTGGAACTCGAGTTCCACAAGATTCTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007107
VALIDATED
SSR3 MISSION shRNA shRNA Plasmid DNA
signal sequence receptor, gamma (translocon-associated protein gamma)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007107.2-488s21c1
Sequence:CCGGTGTTCCTGGTCGTGGTCATTGCTCGAGCAATGACCACGACCAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_007107.2-107s21c1
Sequence:CCGGTGCAGGATTTCAGCCGCAATCCTCGAGGATTGCGGCTGAAATCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007107.2-818s21c1
Sequence:CCGGAGAGTACTAGGACGTTTATTACTCGAGTAATAAACGTCCTAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007107.2-252s21c1
Sequence:CCGGGACCCTAGTAAGCACATATTTCTCGAGAAATATGTGCTTACTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_007107.2-594s21c1
Sequence:CCGGCCTGTCTACTGGCTCCAAATACTCGAGTATTTGGAGCCAGTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007107.2-594s1c1
Sequence:CCGGCCTGTCTACTGGCTCCAAATACTCGAGTATTTGGAGCCAGTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007107.2-252s1c1
Sequence:CCGGGACCCTAGTAAGCACATATTTCTCGAGAAATATGTGCTTACTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007107.2-185s1c1
Sequence:CCGGCCATCTGGTTATACTGGCGAACTCGAGTTCGCCAGTATAACCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_007107.2-547s1c1
Sequence:CCGGGTGAACTACATATTGTCCATACTCGAGTATGGACAATATGTAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007107.2-408s1c1
Sequence:CCGGAGATGAAAGAATCTTGTGGAACTCGAGTTCCACAAGATTCTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007107
VALIDATED
SSR3 MISSION shRNA Lentiviral Transduction Particles
signal sequence receptor, gamma (translocon-associated protein gamma)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007107.2-488s21c1
Sequence:CCGGTGTTCCTGGTCGTGGTCATTGCTCGAGCAATGACCACGACCAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_007107.2-107s21c1
Sequence:CCGGTGCAGGATTTCAGCCGCAATCCTCGAGGATTGCGGCTGAAATCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007107.2-818s21c1
Sequence:CCGGAGAGTACTAGGACGTTTATTACTCGAGTAATAAACGTCCTAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007107.2-252s21c1
Sequence:CCGGGACCCTAGTAAGCACATATTTCTCGAGAAATATGTGCTTACTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_007107.2-594s21c1
Sequence:CCGGCCTGTCTACTGGCTCCAAATACTCGAGTATTTGGAGCCAGTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007107.2-594s1c1
Sequence:CCGGCCTGTCTACTGGCTCCAAATACTCGAGTATTTGGAGCCAGTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007107.2-252s1c1
Sequence:CCGGGACCCTAGTAAGCACATATTTCTCGAGAAATATGTGCTTACTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007107.2-185s1c1
Sequence:CCGGCCATCTGGTTATACTGGCGAACTCGAGTTCGCCAGTATAACCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_007107.2-547s1c1
Sequence:CCGGGTGAACTACATATTGTCCATACTCGAGTATGGACAATATGTAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007107.2-408s1c1
Sequence:CCGGAGATGAAAGAATCTTGTGGAACTCGAGTTCCACAAGATTCTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026155
VALIDATED
SSR3 MISSION shRNA Bacterial Glycerol Stock
signal sequence receptor, gamma (translocon-associated protein gamma)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026155.3-211s21c1
Sequence:CCGGGACCTTAGTAAGCACTTACTTCTCGAGAAGTAAGTGCTTACTAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026155.3-236s21c1
Sequence:CCGGGCCTTCGCGTACAAGAATGTACTCGAGTACATTCTTGTACGCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026155.3-154s21c1
Sequence:CCGGGTATTGGAGAATATGGCATATCTCGAGATATGCCATATTCTCCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026155.3-390s21c1
Sequence:CCGGAGAATGAAGTTGCTGATTATGCTCGAGCATAATCAGCAACTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026155.3-883s21c1
Sequence:CCGGACCTGGACTGAGCTGTTATTACTCGAGTAATAACAGCTCAGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026155.1-1441s1c1
Sequence:CCGGCCAAAGAATTTACAGTGGTTTCTCGAGAAACCACTGTAAATTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026155.1-239s1c1
Sequence:CCGGCTTCGCGTACAAGAATGTAAACTCGAGTTTACATTCTTGTACGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026155.1-237s1c1
Sequence:CCGGGCCTTCGCGTACAAGAATGTACTCGAGTACATTCTTGTACGCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026155.1-155s1c1
Sequence:CCGGGTATTGGAGAATATGGCATATCTCGAGATATGCCATATTCTCCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026155.1-212s1c1
Sequence:CCGGGACCTTAGTAAGCACTTACTTCTCGAGAAGTAAGTGCTTACTAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026155
VALIDATED
SSR3 MISSION shRNA shRNA Plasmid DNA
signal sequence receptor, gamma (translocon-associated protein gamma)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026155.3-211s21c1
Sequence:CCGGGACCTTAGTAAGCACTTACTTCTCGAGAAGTAAGTGCTTACTAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026155.3-236s21c1
Sequence:CCGGGCCTTCGCGTACAAGAATGTACTCGAGTACATTCTTGTACGCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026155.3-154s21c1
Sequence:CCGGGTATTGGAGAATATGGCATATCTCGAGATATGCCATATTCTCCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026155.3-390s21c1
Sequence:CCGGAGAATGAAGTTGCTGATTATGCTCGAGCATAATCAGCAACTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026155.3-883s21c1
Sequence:CCGGACCTGGACTGAGCTGTTATTACTCGAGTAATAACAGCTCAGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026155.1-1441s1c1
Sequence:CCGGCCAAAGAATTTACAGTGGTTTCTCGAGAAACCACTGTAAATTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026155.1-239s1c1
Sequence:CCGGCTTCGCGTACAAGAATGTAAACTCGAGTTTACATTCTTGTACGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026155.1-237s1c1
Sequence:CCGGGCCTTCGCGTACAAGAATGTACTCGAGTACATTCTTGTACGCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026155.1-155s1c1
Sequence:CCGGGTATTGGAGAATATGGCATATCTCGAGATATGCCATATTCTCCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026155.1-212s1c1
Sequence:CCGGGACCTTAGTAAGCACTTACTTCTCGAGAAGTAAGTGCTTACTAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026155
VALIDATED
SSR3 MISSION shRNA Lentiviral Transduction Particles
signal sequence receptor, gamma (translocon-associated protein gamma)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026155.3-211s21c1
Sequence:CCGGGACCTTAGTAAGCACTTACTTCTCGAGAAGTAAGTGCTTACTAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026155.3-236s21c1
Sequence:CCGGGCCTTCGCGTACAAGAATGTACTCGAGTACATTCTTGTACGCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026155.3-154s21c1
Sequence:CCGGGTATTGGAGAATATGGCATATCTCGAGATATGCCATATTCTCCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026155.3-390s21c1
Sequence:CCGGAGAATGAAGTTGCTGATTATGCTCGAGCATAATCAGCAACTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026155.3-883s21c1
Sequence:CCGGACCTGGACTGAGCTGTTATTACTCGAGTAATAACAGCTCAGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026155.1-1441s1c1
Sequence:CCGGCCAAAGAATTTACAGTGGTTTCTCGAGAAACCACTGTAAATTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026155.1-239s1c1
Sequence:CCGGCTTCGCGTACAAGAATGTAAACTCGAGTTTACATTCTTGTACGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026155.1-237s1c1
Sequence:CCGGGCCTTCGCGTACAAGAATGTACTCGAGTACATTCTTGTACGCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026155.1-155s1c1
Sequence:CCGGGTATTGGAGAATATGGCATATCTCGAGATATGCCATATTCTCCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026155.1-212s1c1
Sequence:CCGGGACCTTAGTAAGCACTTACTTCTCGAGAAGTAAGTGCTTACTAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks