EMAIL THIS PAGE TO A FRIEND

SSR4

signal sequence receptor, delta

Synonyms: TRAPD
UniProtKB ID: P51571, A8K378, Q53XY1
Gene ID:
Human(6748) Summary: This gene encodes the delta subunit of the translocon-associated protein complex which is involved in translocating proteins across the endoplasmic reticulum membrane. The encoded protein is located in the Xq28 region and is arranged in a compact head-to-head manner with the isocitrate dehydrogenase 3 (NAD+) gamma gene and both genes are driven by a CpG-embedded bidirectional promoter. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2011]
Mouse(20832) signal sequence receptor, delta
Rat(29435) signal sequence receptor, delta
Zebrafish(326701) signal sequence receptor, delta
domestic cat(101081452) signal sequence receptor, delta
dog(481082) signal sequence receptor, delta
naked mole-rat(101721283) signal sequence receptor, delta
Domestic Rabbit(100328744) signal sequence receptor, delta
domestic guinea pig(100727168) signal sequence receptor, delta
cow(504438) signal sequence receptor, delta
sheep(101110652) signal sequence receptor, delta
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009279 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009279 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009279 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006280 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006280 Rosetta Predictions human pricing
NM_017199 Rosetta Predictions rat pricing
NM_009279 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160032 predicted 341
2 SASI_Hs01_00160033 predicted 341
3 SASI_Hs01_00160034 predicted 399
4 SASI_Hs01_00160036 predicted 238
5 SASI_Hs01_00160037 predicted 342
6 SASI_Hs01_00160038 predicted 214
7 SASI_Hs01_00160039 predicted 337
8 SASI_Hs01_00160040 predicted 193
9 SASI_Hs01_00160041 predicted 337
10 SASI_Hs02_00341257 predicted 227
11 SASI_Hs01_00160035 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017199 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043779 predicted 506
2 SASI_Rn01_00043780 predicted 345
3 SASI_Rn01_00043782 predicted 458
4 SASI_Rn01_00043783 predicted 452
5 SASI_Rn01_00043784 predicted 393
6 SASI_Rn01_00043785 predicted 344
7 SASI_Rn01_00043786 predicted 492
8 SASI_Rn01_00043788 predicted 498
9 SASI_Rn02_00261557 predicted 281
10 SASI_Rn02_00261558 predicted 200
11 SASI_Rn01_00043781 predicted 486
12 SASI_Rn01_00043787 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107006 predicted 471
2 SASI_Mm01_00107007 predicted 357
3 SASI_Mm01_00107008 predicted 339
4 SASI_Mm01_00107009 predicted 497
5 SASI_Mm01_00107010 predicted 461
6 SASI_Mm01_00107011 predicted 468
7 SASI_Mm01_00107012 predicted 406
8 SASI_Mm01_00107013 predicted 469
9 SASI_Mm01_00107014 predicted 469
10 SASI_Mm01_00107015 predicted 524
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009279
VALIDATED
SSR4 MISSION shRNA Bacterial Glycerol Stock
signal sequence receptor, delta
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009279.1-313s1c1
Sequence:CCGGGACTGTATTCATCGTGGAGATCTCGAGATCTCCACGATGAATACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009279.1-285s1c1
Sequence:CCGGCAACTTCAGATGCCGTCATTTCTCGAGAAATGACGGCATCTGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009279.1-471s1c1
Sequence:CCGGCGGGCACCTATGAGGTCAGATCTCGAGATCTGACCTCATAGGTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009279.1-530s1c1
Sequence:CCGGCAGAGAAATAATGAGGACGTTCTCGAGAACGTCCTCATTATTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009279.2-285s21c1
Sequence:CCGGCAACTTCAGATGCCGTCATTTCTCGAGAAATGACGGCATCTGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009279.2-471s21c1
Sequence:CCGGCGGGCACCTATGAGGTCAGATCTCGAGATCTGACCTCATAGGTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009279.2-313s21c1
Sequence:CCGGGACTGTATTCATCGTGGAGATCTCGAGATCTCCACGATGAATACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009279.2-415s21c1
Sequence:CCGGCCAGGATGTGGGTCGATATCACTCGAGTGATATCGACCCACATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009279.2-493s21c1
Sequence:CCGGCTTTGATGAAGAGTCCTATAGCTCGAGCTATAGGACTCTTCATCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009279
VALIDATED
SSR4 MISSION shRNA shRNA Plasmid DNA
signal sequence receptor, delta
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009279.1-313s1c1
Sequence:CCGGGACTGTATTCATCGTGGAGATCTCGAGATCTCCACGATGAATACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009279.1-285s1c1
Sequence:CCGGCAACTTCAGATGCCGTCATTTCTCGAGAAATGACGGCATCTGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009279.1-471s1c1
Sequence:CCGGCGGGCACCTATGAGGTCAGATCTCGAGATCTGACCTCATAGGTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009279.1-530s1c1
Sequence:CCGGCAGAGAAATAATGAGGACGTTCTCGAGAACGTCCTCATTATTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009279.2-285s21c1
Sequence:CCGGCAACTTCAGATGCCGTCATTTCTCGAGAAATGACGGCATCTGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009279.2-471s21c1
Sequence:CCGGCGGGCACCTATGAGGTCAGATCTCGAGATCTGACCTCATAGGTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009279.2-313s21c1
Sequence:CCGGGACTGTATTCATCGTGGAGATCTCGAGATCTCCACGATGAATACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009279.2-415s21c1
Sequence:CCGGCCAGGATGTGGGTCGATATCACTCGAGTGATATCGACCCACATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009279.2-493s21c1
Sequence:CCGGCTTTGATGAAGAGTCCTATAGCTCGAGCTATAGGACTCTTCATCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009279
VALIDATED
SSR4 MISSION shRNA Lentiviral Transduction Particles
signal sequence receptor, delta
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009279.1-313s1c1
Sequence:CCGGGACTGTATTCATCGTGGAGATCTCGAGATCTCCACGATGAATACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009279.1-285s1c1
Sequence:CCGGCAACTTCAGATGCCGTCATTTCTCGAGAAATGACGGCATCTGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009279.1-471s1c1
Sequence:CCGGCGGGCACCTATGAGGTCAGATCTCGAGATCTGACCTCATAGGTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009279.1-530s1c1
Sequence:CCGGCAGAGAAATAATGAGGACGTTCTCGAGAACGTCCTCATTATTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009279.2-285s21c1
Sequence:CCGGCAACTTCAGATGCCGTCATTTCTCGAGAAATGACGGCATCTGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009279.2-471s21c1
Sequence:CCGGCGGGCACCTATGAGGTCAGATCTCGAGATCTGACCTCATAGGTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009279.2-313s21c1
Sequence:CCGGGACTGTATTCATCGTGGAGATCTCGAGATCTCCACGATGAATACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009279.2-415s21c1
Sequence:CCGGCCAGGATGTGGGTCGATATCACTCGAGTGATATCGACCCACATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009279.2-493s21c1
Sequence:CCGGCTTTGATGAAGAGTCCTATAGCTCGAGCTATAGGACTCTTCATCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006280
VALIDATED
SSR4 MISSION shRNA Bacterial Glycerol Stock
signal sequence receptor, delta
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006280.1-187s1c1
Sequence:CCGGGACCGTCTTCATTGTGGAGATCTCGAGATCTCCACAATGAAGACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006280.1-345s1c1
Sequence:CCGGCAGGCACCTATGAGGTTAGATCTCGAGATCTAACCTCATAGGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006280.1-159s1c1
Sequence:CCGGCCACTTCTGACGCTGTCATTTCTCGAGAAATGACAGCGTCAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006280.1-230s1c1
Sequence:CCGGGTCCAGAACATGGCTCTCTATCTCGAGATAGAGAGCCATGTTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006280.1-404s1c1
Sequence:CCGGCAGAGGAATAACGAGGACATTCTCGAGAATGTCCTCGTTATTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006280.1-247s21c1
Sequence:CCGGCTATGCTGACGTCGGTGGAAACTCGAGTTTCCACCGACGTCAGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006280.1-205s21c1
Sequence:CCGGGATCTCCCTGACATGCAAGAACTCGAGTTCTTGCATGTCAGGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006280.1-175s21c1
Sequence:CCGGCATTTCCACTGAGACCGTCTTCTCGAGAAGACGGTCTCAGTGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006280.1-366s21c1
Sequence:CCGGTCTTCGACGAGGAGTCCTACACTCGAGTGTAGGACTCCTCGTCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006280
VALIDATED
SSR4 MISSION shRNA shRNA Plasmid DNA
signal sequence receptor, delta
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006280.1-187s1c1
Sequence:CCGGGACCGTCTTCATTGTGGAGATCTCGAGATCTCCACAATGAAGACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006280.1-345s1c1
Sequence:CCGGCAGGCACCTATGAGGTTAGATCTCGAGATCTAACCTCATAGGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006280.1-159s1c1
Sequence:CCGGCCACTTCTGACGCTGTCATTTCTCGAGAAATGACAGCGTCAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006280.1-230s1c1
Sequence:CCGGGTCCAGAACATGGCTCTCTATCTCGAGATAGAGAGCCATGTTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006280.1-404s1c1
Sequence:CCGGCAGAGGAATAACGAGGACATTCTCGAGAATGTCCTCGTTATTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006280.1-247s21c1
Sequence:CCGGCTATGCTGACGTCGGTGGAAACTCGAGTTTCCACCGACGTCAGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006280.1-205s21c1
Sequence:CCGGGATCTCCCTGACATGCAAGAACTCGAGTTCTTGCATGTCAGGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006280.1-175s21c1
Sequence:CCGGCATTTCCACTGAGACCGTCTTCTCGAGAAGACGGTCTCAGTGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006280.1-366s21c1
Sequence:CCGGTCTTCGACGAGGAGTCCTACACTCGAGTGTAGGACTCCTCGTCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006280
VALIDATED
SSR4 MISSION shRNA Lentiviral Transduction Particles
signal sequence receptor, delta
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006280.1-187s1c1
Sequence:CCGGGACCGTCTTCATTGTGGAGATCTCGAGATCTCCACAATGAAGACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006280.1-345s1c1
Sequence:CCGGCAGGCACCTATGAGGTTAGATCTCGAGATCTAACCTCATAGGTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006280.1-159s1c1
Sequence:CCGGCCACTTCTGACGCTGTCATTTCTCGAGAAATGACAGCGTCAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006280.1-230s1c1
Sequence:CCGGGTCCAGAACATGGCTCTCTATCTCGAGATAGAGAGCCATGTTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006280.1-404s1c1
Sequence:CCGGCAGAGGAATAACGAGGACATTCTCGAGAATGTCCTCGTTATTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006280.1-247s21c1
Sequence:CCGGCTATGCTGACGTCGGTGGAAACTCGAGTTTCCACCGACGTCAGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006280.1-205s21c1
Sequence:CCGGGATCTCCCTGACATGCAAGAACTCGAGTTCTTGCATGTCAGGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006280.1-175s21c1
Sequence:CCGGCATTTCCACTGAGACCGTCTTCTCGAGAAGACGGTCTCAGTGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006280.1-366s21c1
Sequence:CCGGTCTTCGACGAGGAGTCCTACACTCGAGTGTAGGACTCCTCGTCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks