EMAIL THIS PAGE TO A FRIEND

SSRP1

structure specific recognition protein 1

Synonyms: FACT FACT80 T160
UniProtKB ID: Q08945, Q5BJG8
Gene ID:
Human(6749) Summary: The protein encoded by this gene is a subunit of a heterodimer that, along with SUPT16H, forms chromatin transcriptional elongation factor FACT. FACT interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT and cisplatin-damaged DNA may be crucial to the anticancer mechanism of cisplatin. This encoded protein contains a high mobility group box which most likely constitutes the structure recognition element for cisplatin-modified DNA. This protein also functions as a co-activator of the transcriptional activator p63. An alternatively spliced transcript variant of this gene has been described, but its full-length nature is not known. [provided by RefSeq, Jul 2008]
Mouse(20833) structure specific recognition protein 1
Rat(81785) structure specific recognition protein 1
chicken(396509) structure specific recognition protein 1
dog(475970) structure specific recognition protein 1
domestic cat(101089296) structure specific recognition protein 1
Horse(100066933) structure specific recognition protein 1
cow(282082) structure specific recognition protein 1
sheep(101104524) structure specific recognition protein 1
domestic guinea pig(100723239) structure specific recognition protein 1
naked mole-rat(101696992) structure specific recognition protein 1
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA002697 Anti-SSRP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV38249 Anti-SSRP1 antibody produced in rabbit affinity isolated antibody human, rat, bovine, mouse, guinea pig, horse,
western blot pricing
SAB2103445 Anti-SSRP1 antibody produced in rabbit affinity isolated antibody human, rabbit, bovine, horse, rat, guinea pig, mouse
western blot pricing
SAB2104008 Anti-SSRP1 antibody produced in rabbit affinity isolated antibody zebrafish, rat, bovine, mouse, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003146 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003146 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003146 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182990 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182990 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182990 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003146 Rosetta Predictions human pricing
NM_031121 Rosetta Predictions rat pricing
NM_182990 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003146 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216184 predicted 2245
2 SASI_Hs01_00216185 predicted 1698
3 SASI_Hs01_00216186 predicted 733
4 SASI_Hs01_00216187 predicted 1407
5 SASI_Hs01_00216188 predicted 1123
6 SASI_Hs01_00216189 predicted 1922
7 SASI_Hs01_00216190 predicted 1589
8 SASI_Hs01_00216191 predicted 1857
9 SASI_Hs01_00216193 predicted 2124
10 SASI_Hs02_00335151 predicted 1609
11 SASI_Hs01_00216192 predicted 1383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031121 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050546 predicted 685
2 SASI_Rn01_00050547 predicted 1586
3 SASI_Rn02_00264428 predicted 1300
4 SASI_Rn01_00050550 predicted 751
5 SASI_Rn01_00050551 predicted 759
6 SASI_Rn01_00050552 predicted 2028
7 SASI_Rn01_00050553 predicted 1961
8 SASI_Rn01_00050554 predicted 1240
9 SASI_Rn01_00050555 predicted 921
10 SASI_Rn02_00264429 predicted 1401
11 SASI_Rn01_00050548 predicted 307
12 SASI_Rn01_00050549 predicted 2506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182990 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027613 predicted 656
2 SASI_Mm01_00027614 predicted 1195
3 SASI_Mm01_00027615 predicted 721
4 SASI_Mm01_00027616 predicted 1266
5 SASI_Mm01_00027617 predicted 1105
6 SASI_Mm01_00027618 predicted 895
7 SASI_Mm01_00027620 predicted 1546
8 SASI_Mm01_00027621 predicted 1591
9 SASI_Mm02_00349998 predicted 1446
10 SASI_Mm01_00027622 predicted 2440
11 SASI_Mm01_00027619 predicted 1835
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003146
VALIDATED
SSRP1 MISSION shRNA Bacterial Glycerol Stock
structure specific recognition protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003146.2-942s21c1
Sequence:CCGGGCATGGCAAGACCTTTGACTACTCGAGTAGTCAAAGGTCTTGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003146.2-1375s21c1
Sequence:CCGGCGCTTCGATGAGATCTCCTTTCTCGAGAAAGGAGATCTCATCGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003146.2-1679s21c1
Sequence:CCGGGCGATGACTCAGGAGAAGAAACTCGAGTTTCTTCTCCTGAGTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003146.2-443s21c1
Sequence:CCGGGCCATGGACTTAAACTGCTTACTCGAGTAAGCAGTTTAAGTCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003146.2-2124s21c1
Sequence:CCGGCGAGTCTTCTAAGAGGGACAACTCGAGTTGTCCCTCTTAGAAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003146.2-2124s1c1
Sequence:CCGGCGAGTCTTCTAAGAGGGACAACTCGAGTTGTCCCTCTTAGAAGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_003146.2-1679s1c1
Sequence:CCGGGCGATGACTCAGGAGAAGAAACTCGAGTTTCTTCTCCTGAGTCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003146.2-942s1c1
Sequence:CCGGGCATGGCAAGACCTTTGACTACTCGAGTAGTCAAAGGTCTTGCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003146.2-443s1c1
Sequence:CCGGGCCATGGACTTAAACTGCTTACTCGAGTAAGCAGTTTAAGTCCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003146.2-1375s1c1
Sequence:CCGGCGCTTCGATGAGATCTCCTTTCTCGAGAAAGGAGATCTCATCGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003146
VALIDATED
SSRP1 MISSION shRNA shRNA Plasmid DNA
structure specific recognition protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003146.2-942s21c1
Sequence:CCGGGCATGGCAAGACCTTTGACTACTCGAGTAGTCAAAGGTCTTGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003146.2-1375s21c1
Sequence:CCGGCGCTTCGATGAGATCTCCTTTCTCGAGAAAGGAGATCTCATCGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003146.2-1679s21c1
Sequence:CCGGGCGATGACTCAGGAGAAGAAACTCGAGTTTCTTCTCCTGAGTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003146.2-443s21c1
Sequence:CCGGGCCATGGACTTAAACTGCTTACTCGAGTAAGCAGTTTAAGTCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003146.2-2124s21c1
Sequence:CCGGCGAGTCTTCTAAGAGGGACAACTCGAGTTGTCCCTCTTAGAAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003146.2-2124s1c1
Sequence:CCGGCGAGTCTTCTAAGAGGGACAACTCGAGTTGTCCCTCTTAGAAGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_003146.2-1679s1c1
Sequence:CCGGGCGATGACTCAGGAGAAGAAACTCGAGTTTCTTCTCCTGAGTCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003146.2-942s1c1
Sequence:CCGGGCATGGCAAGACCTTTGACTACTCGAGTAGTCAAAGGTCTTGCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003146.2-443s1c1
Sequence:CCGGGCCATGGACTTAAACTGCTTACTCGAGTAAGCAGTTTAAGTCCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003146.2-1375s1c1
Sequence:CCGGCGCTTCGATGAGATCTCCTTTCTCGAGAAAGGAGATCTCATCGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003146
VALIDATED
SSRP1 MISSION shRNA Lentiviral Transduction Particles
structure specific recognition protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003146.2-942s21c1
Sequence:CCGGGCATGGCAAGACCTTTGACTACTCGAGTAGTCAAAGGTCTTGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003146.2-1375s21c1
Sequence:CCGGCGCTTCGATGAGATCTCCTTTCTCGAGAAAGGAGATCTCATCGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003146.2-1679s21c1
Sequence:CCGGGCGATGACTCAGGAGAAGAAACTCGAGTTTCTTCTCCTGAGTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003146.2-443s21c1
Sequence:CCGGGCCATGGACTTAAACTGCTTACTCGAGTAAGCAGTTTAAGTCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003146.2-2124s21c1
Sequence:CCGGCGAGTCTTCTAAGAGGGACAACTCGAGTTGTCCCTCTTAGAAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003146.2-2124s1c1
Sequence:CCGGCGAGTCTTCTAAGAGGGACAACTCGAGTTGTCCCTCTTAGAAGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_003146.2-1679s1c1
Sequence:CCGGGCGATGACTCAGGAGAAGAAACTCGAGTTTCTTCTCCTGAGTCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003146.2-942s1c1
Sequence:CCGGGCATGGCAAGACCTTTGACTACTCGAGTAGTCAAAGGTCTTGCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003146.2-443s1c1
Sequence:CCGGGCCATGGACTTAAACTGCTTACTCGAGTAAGCAGTTTAAGTCCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003146.2-1375s1c1
Sequence:CCGGCGCTTCGATGAGATCTCCTTTCTCGAGAAAGGAGATCTCATCGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182990
VALIDATED
SSRP1 MISSION shRNA Bacterial Glycerol Stock
structure specific recognition protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182990.3-1724s21c1
Sequence:CCGGGCAGAGGAGTTTGACAGCAATCTCGAGATTGCTGTCAAACTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182990.3-1264s21c1
Sequence:CCGGCCAGTGTATTACCTGCTCCTACTCGAGTAGGAGCAGGTAATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182990.3-908s21c1
Sequence:CCGGCCTACCTTTCTACACCTGCATCTCGAGATGCAGGTGTAGAAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182990.3-328s21c1
Sequence:CCGGCCGTCAGGGTATCATCTTTAACTCGAGTTAAAGATGATACCCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182990.3-1907s21c1
Sequence:CCGGGCGTACATGCTGTGGCTTAATCTCGAGATTAAGCCACAGCATGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182990.1-257s1c1
Sequence:CCGGCCGTCAGGGTATCATCTTTAACTCGAGTTAAAGATGATACCCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182990.1-1653s1c1
Sequence:CCGGGCAGAGGAGTTTGACAGCAATCTCGAGATTGCTGTCAAACTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182990.1-1836s1c1
Sequence:CCGGGCGTACATGCTGTGGCTTAATCTCGAGATTAAGCCACAGCATGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182990.1-837s1c1
Sequence:CCGGCCTACCTTTCTACACCTGCATCTCGAGATGCAGGTGTAGAAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182990.1-1193s1c1
Sequence:CCGGCCAGTGTATTACCTGCTCCTACTCGAGTAGGAGCAGGTAATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182990
VALIDATED
SSRP1 MISSION shRNA shRNA Plasmid DNA
structure specific recognition protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182990.3-1724s21c1
Sequence:CCGGGCAGAGGAGTTTGACAGCAATCTCGAGATTGCTGTCAAACTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182990.3-1264s21c1
Sequence:CCGGCCAGTGTATTACCTGCTCCTACTCGAGTAGGAGCAGGTAATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182990.3-908s21c1
Sequence:CCGGCCTACCTTTCTACACCTGCATCTCGAGATGCAGGTGTAGAAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182990.3-328s21c1
Sequence:CCGGCCGTCAGGGTATCATCTTTAACTCGAGTTAAAGATGATACCCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182990.3-1907s21c1
Sequence:CCGGGCGTACATGCTGTGGCTTAATCTCGAGATTAAGCCACAGCATGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182990.1-257s1c1
Sequence:CCGGCCGTCAGGGTATCATCTTTAACTCGAGTTAAAGATGATACCCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182990.1-1653s1c1
Sequence:CCGGGCAGAGGAGTTTGACAGCAATCTCGAGATTGCTGTCAAACTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182990.1-1836s1c1
Sequence:CCGGGCGTACATGCTGTGGCTTAATCTCGAGATTAAGCCACAGCATGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182990.1-837s1c1
Sequence:CCGGCCTACCTTTCTACACCTGCATCTCGAGATGCAGGTGTAGAAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182990.1-1193s1c1
Sequence:CCGGCCAGTGTATTACCTGCTCCTACTCGAGTAGGAGCAGGTAATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182990
VALIDATED
SSRP1 MISSION shRNA Lentiviral Transduction Particles
structure specific recognition protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182990.3-1724s21c1
Sequence:CCGGGCAGAGGAGTTTGACAGCAATCTCGAGATTGCTGTCAAACTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182990.3-1264s21c1
Sequence:CCGGCCAGTGTATTACCTGCTCCTACTCGAGTAGGAGCAGGTAATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182990.3-908s21c1
Sequence:CCGGCCTACCTTTCTACACCTGCATCTCGAGATGCAGGTGTAGAAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182990.3-328s21c1
Sequence:CCGGCCGTCAGGGTATCATCTTTAACTCGAGTTAAAGATGATACCCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_182990.3-1907s21c1
Sequence:CCGGGCGTACATGCTGTGGCTTAATCTCGAGATTAAGCCACAGCATGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_182990.1-257s1c1
Sequence:CCGGCCGTCAGGGTATCATCTTTAACTCGAGTTAAAGATGATACCCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182990.1-1653s1c1
Sequence:CCGGGCAGAGGAGTTTGACAGCAATCTCGAGATTGCTGTCAAACTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182990.1-1836s1c1
Sequence:CCGGGCGTACATGCTGTGGCTTAATCTCGAGATTAAGCCACAGCATGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182990.1-837s1c1
Sequence:CCGGCCTACCTTTCTACACCTGCATCTCGAGATGCAGGTGTAGAAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182990.1-1193s1c1
Sequence:CCGGCCAGTGTATTACCTGCTCCTACTCGAGTAGGAGCAGGTAATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks