EMAIL THIS PAGE TO A FRIEND

SSSCA1

Sjogren syndrome/scleroderma autoantigen 1

Synonyms: p27
UniProtKB ID: O60232
Gene ID:
Human(10534) Summary: This antigen is recognized by a subset of anti-centromere antibodies from patients with scleroderma and/or Sjogren's syndrome. Subcellular localization has not yet been established. [provided by RefSeq, Jul 2008]
Mouse(56390) Sjogren's syndrome/scleroderma autoantigen 1 homolog (human)
Rat(689397) Sjogren syndrome/scleroderma autoantigen 1
cow(511466) Sjogren syndrome/scleroderma autoantigen 1
sheep(101108437) Sjogren syndrome/scleroderma autoantigen 1
naked mole-rat(101719848) Sjogren syndrome/scleroderma autoantigen 1
domestic guinea pig(100729445) Sjogren syndrome/scleroderma autoantigen 1
Zebrafish(449989) Sjogren syndrome/scleroderma autoantigen 1
domestic cat(101086421) Sjogren syndrome/scleroderma autoantigen 1
dog(476024) Sjogren syndrome/scleroderma autoantigen 1
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006396 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006396 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006396 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020491 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020491 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020491 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006396 Rosetta Predictions human pricing
NM_001109537 Rosetta Predictions rat pricing
NM_020491 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114866 predicted 201
2 SASI_Hs01_00114867 predicted 243
3 SASI_Hs01_00114868 predicted 241
4 SASI_Hs01_00114869 predicted 220
5 SASI_Hs01_00114870 predicted 250
6 SASI_Hs01_00114871 predicted 249
7 SASI_Hs01_00114872 predicted 225
8 SASI_Hs01_00114873 predicted 368
9 SASI_Hs01_00114874 predicted 289
10 SASI_Hs01_00114875 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109537 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249379 predicted 275
2 SASI_Rn02_00249380 predicted 261
3 SASI_Rn02_00249381 predicted 325
4 SASI_Rn02_00249382 predicted 261
5 SASI_Rn02_00249383 predicted 580
6 SASI_Rn02_00249384 predicted 224
7 SASI_Rn02_00249385 predicted 322
8 SASI_Rn02_00249386 predicted 363
9 SASI_Rn02_00249387 predicted 267
10 SASI_Rn02_00249388 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020491 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325537 predicted 255
2 SASI_Mm01_00090998 predicted 245
3 SASI_Mm01_00090999 predicted 206
4 SASI_Mm02_00325538 predicted 251
5 SASI_Mm02_00325539 predicted 436
6 SASI_Mm02_00325540 predicted 313
7 SASI_Mm01_00091002 predicted 300
8 SASI_Mm01_00091005 predicted 249
9 SASI_Mm01_00091006 predicted 301
10 SASI_Mm01_00091007 predicted 289
11 SASI_Mm01_00091000 predicted 236
12 SASI_Mm01_00091001 predicted 471
13 SASI_Mm01_00091003 predicted 463
14 SASI_Mm01_00091004 predicted 467
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006396
VALIDATED
SSSCA1 MISSION shRNA Bacterial Glycerol Stock
Sjogren syndrome/scleroderma autoantigen 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006396.1-449s1c1
Sequence:CCGGGCCTCCAAATACAGATGTCATCTCGAGATGACATCTGTATTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006396.1-249s1c1
Sequence:CCGGGACTCAGACGTGGATAAAGATCTCGAGATCTTTATCCACGTCTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006396.1-246s1c1
Sequence:CCGGCTCGACTCAGACGTGGATAAACTCGAGTTTATCCACGTCTGAGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006396.1-201s1c1
Sequence:CCGGCTCCAAGACAAACAGCGGAAACTCGAGTTTCCGCTGTTTGTCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006396.1-138s21c1
Sequence:CCGGGACTATCTGCTGCGCGGTTACCTCGAGGTAACCGCGCAGCAGATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006396.1-263s21c1
Sequence:CCGGTAAAGATAATCCCGCTCTGAACTCGAGTTCAGAGCGGGATTATCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006396.1-246s21c1
Sequence:CCGGCTCGACTCAGACGTGGATAAACTCGAGTTTATCCACGTCTGAGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006396.1-235s21c1
Sequence:CCGGCTTGTCAGGAACTCGACTCAGCTCGAGCTGAGTCGAGTTCCTGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006396
VALIDATED
SSSCA1 MISSION shRNA shRNA Plasmid DNA
Sjogren syndrome/scleroderma autoantigen 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006396.1-449s1c1
Sequence:CCGGGCCTCCAAATACAGATGTCATCTCGAGATGACATCTGTATTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006396.1-249s1c1
Sequence:CCGGGACTCAGACGTGGATAAAGATCTCGAGATCTTTATCCACGTCTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006396.1-246s1c1
Sequence:CCGGCTCGACTCAGACGTGGATAAACTCGAGTTTATCCACGTCTGAGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006396.1-201s1c1
Sequence:CCGGCTCCAAGACAAACAGCGGAAACTCGAGTTTCCGCTGTTTGTCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006396.1-138s21c1
Sequence:CCGGGACTATCTGCTGCGCGGTTACCTCGAGGTAACCGCGCAGCAGATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006396.1-263s21c1
Sequence:CCGGTAAAGATAATCCCGCTCTGAACTCGAGTTCAGAGCGGGATTATCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006396.1-246s21c1
Sequence:CCGGCTCGACTCAGACGTGGATAAACTCGAGTTTATCCACGTCTGAGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006396.1-235s21c1
Sequence:CCGGCTTGTCAGGAACTCGACTCAGCTCGAGCTGAGTCGAGTTCCTGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006396
VALIDATED
SSSCA1 MISSION shRNA Lentiviral Transduction Particles
Sjogren syndrome/scleroderma autoantigen 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006396.1-449s1c1
Sequence:CCGGGCCTCCAAATACAGATGTCATCTCGAGATGACATCTGTATTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006396.1-249s1c1
Sequence:CCGGGACTCAGACGTGGATAAAGATCTCGAGATCTTTATCCACGTCTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006396.1-246s1c1
Sequence:CCGGCTCGACTCAGACGTGGATAAACTCGAGTTTATCCACGTCTGAGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006396.1-201s1c1
Sequence:CCGGCTCCAAGACAAACAGCGGAAACTCGAGTTTCCGCTGTTTGTCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006396.1-138s21c1
Sequence:CCGGGACTATCTGCTGCGCGGTTACCTCGAGGTAACCGCGCAGCAGATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006396.1-263s21c1
Sequence:CCGGTAAAGATAATCCCGCTCTGAACTCGAGTTCAGAGCGGGATTATCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006396.1-246s21c1
Sequence:CCGGCTCGACTCAGACGTGGATAAACTCGAGTTTATCCACGTCTGAGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006396.1-235s21c1
Sequence:CCGGCTTGTCAGGAACTCGACTCAGCTCGAGCTGAGTCGAGTTCCTGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020491
SSSCA1 MISSION shRNA Bacterial Glycerol Stock
Sjogren syndrome/scleroderma autoantigen 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020491.3-248s1c1
Sequence:CCGGGACTCAGACGTGGATAAAGATCTCGAGATCTTTATCCACGTCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020491.3-827s1c1
Sequence:CCGGGAGGGATAAGTGACACCTTATCTCGAGATAAGGTGTCACTTATCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020491.3-933s1c1
Sequence:CCGGCATTTGAAGTTTCAGTCCCTTCTCGAGAAGGGACTGAAACTTCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020491.3-972s1c1
Sequence:CCGGCCTTTAACCATCCTGACTCTACTCGAGTAGAGTCAGGATGGTTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020491.3-257s1c1
Sequence:CCGGGTGGATAAAGATAACCCGGCACTCGAGTGCCGGGTTATCTTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198366    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020491.3-1013s1c1
Sequence:CCGGGCTGCTAGGATGTTGACAAATCTCGAGATTTGTCAACATCCTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020491.3-199s1c1
Sequence:CCGGCCTGCAAGATAAACAGCGGAACTCGAGTTCCGCTGTTTATCTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020491.3-190s1c1
Sequence:CCGGGACGATCCTCCTGCAAGATAACTCGAGTTATCTTGCAGGAGGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020491.4-229s21c1
Sequence:CCGGATCTACTGTGTGGCTTGTCAGCTCGAGCTGACAAGCCACACAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020491.4-75s21c1
Sequence:CCGGGACTGAAGCTGAGACGAAGGTCTCGAGACCTTCGTCTCAGCTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020491.4-446s21c1
Sequence:CCGGTTCCGGCTGCACCTCCAAATACTCGAGTATTTGGAGGTGCAGCCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020491.4-199s21c1
Sequence:CCGGACGATCCTCCTGCAAGATAAACTCGAGTTTATCTTGCAGGAGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020491.4-256s21c1
Sequence:CCGGGACTCAGACGTGGATAAAGATCTCGAGATCTTTATCCACGTCTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020491
SSSCA1 MISSION shRNA shRNA Plasmid DNA
Sjogren syndrome/scleroderma autoantigen 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020491.3-248s1c1
Sequence:CCGGGACTCAGACGTGGATAAAGATCTCGAGATCTTTATCCACGTCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020491.3-827s1c1
Sequence:CCGGGAGGGATAAGTGACACCTTATCTCGAGATAAGGTGTCACTTATCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020491.3-933s1c1
Sequence:CCGGCATTTGAAGTTTCAGTCCCTTCTCGAGAAGGGACTGAAACTTCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020491.3-972s1c1
Sequence:CCGGCCTTTAACCATCCTGACTCTACTCGAGTAGAGTCAGGATGGTTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020491.3-257s1c1
Sequence:CCGGGTGGATAAAGATAACCCGGCACTCGAGTGCCGGGTTATCTTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198366    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020491.3-1013s1c1
Sequence:CCGGGCTGCTAGGATGTTGACAAATCTCGAGATTTGTCAACATCCTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020491.3-199s1c1
Sequence:CCGGCCTGCAAGATAAACAGCGGAACTCGAGTTCCGCTGTTTATCTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020491.3-190s1c1
Sequence:CCGGGACGATCCTCCTGCAAGATAACTCGAGTTATCTTGCAGGAGGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020491.4-229s21c1
Sequence:CCGGATCTACTGTGTGGCTTGTCAGCTCGAGCTGACAAGCCACACAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020491.4-75s21c1
Sequence:CCGGGACTGAAGCTGAGACGAAGGTCTCGAGACCTTCGTCTCAGCTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020491.4-446s21c1
Sequence:CCGGTTCCGGCTGCACCTCCAAATACTCGAGTATTTGGAGGTGCAGCCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020491.4-199s21c1
Sequence:CCGGACGATCCTCCTGCAAGATAAACTCGAGTTTATCTTGCAGGAGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020491.4-256s21c1
Sequence:CCGGGACTCAGACGTGGATAAAGATCTCGAGATCTTTATCCACGTCTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020491
SSSCA1 MISSION shRNA Lentiviral Transduction Particles
Sjogren syndrome/scleroderma autoantigen 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020491.3-248s1c1
Sequence:CCGGGACTCAGACGTGGATAAAGATCTCGAGATCTTTATCCACGTCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020491.3-827s1c1
Sequence:CCGGGAGGGATAAGTGACACCTTATCTCGAGATAAGGTGTCACTTATCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020491.3-933s1c1
Sequence:CCGGCATTTGAAGTTTCAGTCCCTTCTCGAGAAGGGACTGAAACTTCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020491.3-972s1c1
Sequence:CCGGCCTTTAACCATCCTGACTCTACTCGAGTAGAGTCAGGATGGTTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020491.3-257s1c1
Sequence:CCGGGTGGATAAAGATAACCCGGCACTCGAGTGCCGGGTTATCTTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198366    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020491.3-1013s1c1
Sequence:CCGGGCTGCTAGGATGTTGACAAATCTCGAGATTTGTCAACATCCTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020491.3-199s1c1
Sequence:CCGGCCTGCAAGATAAACAGCGGAACTCGAGTTCCGCTGTTTATCTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020491.3-190s1c1
Sequence:CCGGGACGATCCTCCTGCAAGATAACTCGAGTTATCTTGCAGGAGGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020491.4-229s21c1
Sequence:CCGGATCTACTGTGTGGCTTGTCAGCTCGAGCTGACAAGCCACACAGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020491.4-75s21c1
Sequence:CCGGGACTGAAGCTGAGACGAAGGTCTCGAGACCTTCGTCTCAGCTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020491.4-446s21c1
Sequence:CCGGTTCCGGCTGCACCTCCAAATACTCGAGTATTTGGAGGTGCAGCCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020491.4-199s21c1
Sequence:CCGGACGATCCTCCTGCAAGATAAACTCGAGTTTATCTTGCAGGAGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020491.4-256s21c1
Sequence:CCGGGACTCAGACGTGGATAAAGATCTCGAGATCTTTATCCACGTCTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks