EMAIL THIS PAGE TO A FRIEND

SST

somatostatin

Synonyms: SMST
UniProtKB ID: P61278, B2R5G3, P01166
Gene ID:
Human(6750) Summary: The hormone somatostatin has active 14 aa and 28 aa forms that are produced by alternate cleavage of the single preproprotein encoded by this gene. Somatostatin is expressed throughout the body and inhibits the release of numerous secondary hormones by binding to high-affinity G-protein-coupled somatostatin receptors. This hormone is an important regulator of the endocrine system through its interactions with pituitary growth hormone, thyroid stimulating hormone, and most hormones of the gastrointestinal tract. Somatostatin also affects rates of neurotransmission in the central nervous system and proliferation of both normal and tumorigenic cells. [provided by RefSeq, Jul 2008]
Mouse(20604) somatostatin
Rat(24797) somatostatin
chicken(396279) somatostatin
dog(403993) somatostatin
cow(280932) somatostatin
sheep(443006) somatostatin
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
C4801 Cyclo(7-aminoheptanoyl-Phe-D-Trp-Lys-Thr[Bzl]) ≥95% (HPLC), powder human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009215 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009215 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009215 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001048 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001048 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001048 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057931 MISSION® esiRNA esiRNA human SST (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001048 Rosetta Predictions human pricing
NM_012659 Rosetta Predictions rat pricing
NM_009215 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311527 predicted 208
2 SASI_Hs01_00085645 predicted 306
3 SASI_Hs01_00085646 predicted 300
4 SASI_Hs01_00085648 predicted 307
5 SASI_Hs02_00311528 predicted 277
6 SASI_Hs01_00085651 predicted 209
7 SASI_Hs01_00085652 predicted 254
8 SASI_Hs02_00311529 predicted 250
9 SASI_Hs02_00311530 predicted 309
10 SASI_Hs02_00311531 predicted 311
11 SASI_Hs01_00085643 predicted 270
12 SASI_Hs01_00085644 predicted 318
13 SASI_Hs01_00085647 predicted 371
14 SASI_Hs01_00085649 predicted 380
15 SASI_Hs01_00085650 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012659 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062977 predicted 250
2 SASI_Rn01_00062979 predicted 231
3 SASI_Rn01_00062981 predicted 196
4 SASI_Rn01_00062982 predicted 245
5 SASI_Rn01_00062983 predicted 209
6 SASI_Rn01_00062984 predicted 206
7 SASI_Rn01_00062976 predicted 197
8 SASI_Rn01_00062980 predicted 202
9 SASI_Rn02_00259911 predicted 255
10 SASI_Rn01_00062985 predicted 404
11 SASI_Rn01_00062978 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009215 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061965 predicted 289
2 SASI_Mm01_00061967 predicted 210
3 SASI_Mm01_00061969 predicted 320
4 SASI_Mm01_00061970 predicted 272
5 SASI_Mm01_00061971 predicted 296
6 SASI_Mm01_00061972 predicted 264
7 SASI_Mm02_00315623 predicted 215
8 SASI_Mm02_00315624 predicted 218
9 SASI_Mm02_00315625 predicted 218
10 SASI_Mm01_00061966 predicted 238
11 SASI_Mm01_00061968 predicted 226
12 SASI_Mm01_00061973 predicted 242
13 SASI_Mm01_00061974 predicted 351
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009215
SST MISSION shRNA Bacterial Glycerol Stock
somatostatin
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009215.1-274s21c1
Sequence:CCGGCGAGCCCAACCAGACAGAGAACTCGAGTTCTCTGTCTGGTTGGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009215.1-400s21c1
Sequence:CCGGACGCAAAGCTGGCTGCAAGAACTCGAGTTCTTGCAGCCAGCTTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009215.1-367s21c1
Sequence:CCGGTGCCAACTCGAACCCAGCAATCTCGAGATTGCTGGGTTCGAGTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009215.1-430s1c1
Sequence:CCGGGAAGACATTCACATCCTGTTACTCGAGTAACAGGATGTGAATGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009215.1-192s1c1
Sequence:CCGGTCCGTCAGTTTCTGCAGAAGTCTCGAGACTTCTGCAGAAACTGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009215.1-283s1c1
Sequence:CCGGCCAGACAGAGAATGATGCCCTCTCGAGAGGGCATCATTCTCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009215.1-247s1c1
Sequence:CCGGCAAGTACTTCTTGGCAGAGCTCTCGAGAGCTCTGCCAAGAAGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009215.1-358s1c1
Sequence:CCGGGCAGAGGTCTGCCAACTCGAACTCGAGTTCGAGTTGGCAGACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009215
SST MISSION shRNA shRNA Plasmid DNA
somatostatin
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009215.1-274s21c1
Sequence:CCGGCGAGCCCAACCAGACAGAGAACTCGAGTTCTCTGTCTGGTTGGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009215.1-400s21c1
Sequence:CCGGACGCAAAGCTGGCTGCAAGAACTCGAGTTCTTGCAGCCAGCTTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009215.1-367s21c1
Sequence:CCGGTGCCAACTCGAACCCAGCAATCTCGAGATTGCTGGGTTCGAGTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009215.1-430s1c1
Sequence:CCGGGAAGACATTCACATCCTGTTACTCGAGTAACAGGATGTGAATGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009215.1-192s1c1
Sequence:CCGGTCCGTCAGTTTCTGCAGAAGTCTCGAGACTTCTGCAGAAACTGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009215.1-283s1c1
Sequence:CCGGCCAGACAGAGAATGATGCCCTCTCGAGAGGGCATCATTCTCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009215.1-247s1c1
Sequence:CCGGCAAGTACTTCTTGGCAGAGCTCTCGAGAGCTCTGCCAAGAAGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009215.1-358s1c1
Sequence:CCGGGCAGAGGTCTGCCAACTCGAACTCGAGTTCGAGTTGGCAGACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009215
SST MISSION shRNA Lentiviral Transduction Particles
somatostatin
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009215.1-274s21c1
Sequence:CCGGCGAGCCCAACCAGACAGAGAACTCGAGTTCTCTGTCTGGTTGGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009215.1-400s21c1
Sequence:CCGGACGCAAAGCTGGCTGCAAGAACTCGAGTTCTTGCAGCCAGCTTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009215.1-367s21c1
Sequence:CCGGTGCCAACTCGAACCCAGCAATCTCGAGATTGCTGGGTTCGAGTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009215.1-430s1c1
Sequence:CCGGGAAGACATTCACATCCTGTTACTCGAGTAACAGGATGTGAATGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009215.1-192s1c1
Sequence:CCGGTCCGTCAGTTTCTGCAGAAGTCTCGAGACTTCTGCAGAAACTGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009215.1-283s1c1
Sequence:CCGGCCAGACAGAGAATGATGCCCTCTCGAGAGGGCATCATTCTCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009215.1-247s1c1
Sequence:CCGGCAAGTACTTCTTGGCAGAGCTCTCGAGAGCTCTGCCAAGAAGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009215.1-358s1c1
Sequence:CCGGGCAGAGGTCTGCCAACTCGAACTCGAGTTCGAGTTGGCAGACCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001048
SST MISSION shRNA Bacterial Glycerol Stock
somatostatin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048.3-422s21c1
Sequence:CCGGACGCAAAGCTGGCTGCAAGAACTCGAGTTCTTGCAGCCAGCTTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048.3-487s21c1
Sequence:CCGGTATTGTCCATATCAGACCTCTCTCGAGAGAGGTCTGATATGGACAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048.3-259s21c1
Sequence:CCGGAGGAACTGGCCAAGTACTTCTCTCGAGAGAAGTACTTGGCCAGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048.3-219s21c1
Sequence:CCGGCAGTTTCTGCAGAAGTCCCTGCTCGAGCAGGGACTTCTGCAGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001048.2-470s1c1
Sequence:CCGGCCCTTGCATTAGAAACTGAAACTCGAGTTTCAGTTTCTAATGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001048.2-294s1c1
Sequence:CCGGTGCTAACTCAAACCCGGCTATCTCGAGATAGCCGGGTTTGAGTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001048.2-205s1c1
Sequence:CCGGCCCAACCAGACGGAGAATGATCTCGAGATCATTCTCCGTCTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001048.2-259s1c1
Sequence:CCGGGAGCAGGATGAAATGAGGCTTCTCGAGAAGCCTCATTTCATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001048.2-357s1c1
Sequence:CCGGGAAGACTTTCACATCCTGTTACTCGAGTAACAGGATGTGAAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001048
SST MISSION shRNA shRNA Plasmid DNA
somatostatin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048.3-422s21c1
Sequence:CCGGACGCAAAGCTGGCTGCAAGAACTCGAGTTCTTGCAGCCAGCTTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048.3-487s21c1
Sequence:CCGGTATTGTCCATATCAGACCTCTCTCGAGAGAGGTCTGATATGGACAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048.3-259s21c1
Sequence:CCGGAGGAACTGGCCAAGTACTTCTCTCGAGAGAAGTACTTGGCCAGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048.3-219s21c1
Sequence:CCGGCAGTTTCTGCAGAAGTCCCTGCTCGAGCAGGGACTTCTGCAGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001048.2-470s1c1
Sequence:CCGGCCCTTGCATTAGAAACTGAAACTCGAGTTTCAGTTTCTAATGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001048.2-294s1c1
Sequence:CCGGTGCTAACTCAAACCCGGCTATCTCGAGATAGCCGGGTTTGAGTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001048.2-205s1c1
Sequence:CCGGCCCAACCAGACGGAGAATGATCTCGAGATCATTCTCCGTCTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001048.2-259s1c1
Sequence:CCGGGAGCAGGATGAAATGAGGCTTCTCGAGAAGCCTCATTTCATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001048.2-357s1c1
Sequence:CCGGGAAGACTTTCACATCCTGTTACTCGAGTAACAGGATGTGAAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001048
SST MISSION shRNA Lentiviral Transduction Particles
somatostatin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048.3-422s21c1
Sequence:CCGGACGCAAAGCTGGCTGCAAGAACTCGAGTTCTTGCAGCCAGCTTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048.3-487s21c1
Sequence:CCGGTATTGTCCATATCAGACCTCTCTCGAGAGAGGTCTGATATGGACAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048.3-259s21c1
Sequence:CCGGAGGAACTGGCCAAGTACTTCTCTCGAGAGAAGTACTTGGCCAGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048.3-219s21c1
Sequence:CCGGCAGTTTCTGCAGAAGTCCCTGCTCGAGCAGGGACTTCTGCAGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001048.2-470s1c1
Sequence:CCGGCCCTTGCATTAGAAACTGAAACTCGAGTTTCAGTTTCTAATGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001048.2-294s1c1
Sequence:CCGGTGCTAACTCAAACCCGGCTATCTCGAGATAGCCGGGTTTGAGTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001048.2-205s1c1
Sequence:CCGGCCCAACCAGACGGAGAATGATCTCGAGATCATTCTCCGTCTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001048.2-259s1c1
Sequence:CCGGGAGCAGGATGAAATGAGGCTTCTCGAGAAGCCTCATTTCATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001048.2-357s1c1
Sequence:CCGGGAAGACTTTCACATCCTGTTACTCGAGTAACAGGATGTGAAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks