EMAIL THIS PAGE TO A FRIEND

SSTR1

somatostatin receptor 1

Synonyms: SRIF-2 SS-1-R SS1-R SS1R
UniProtKB ID: P30872
Gene ID:
Human(6751) Summary: Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. The protein encoded by this gene is a member of the superfamily of somatostatin receptors having seven transmembrane segments. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This somatostatin receptor has greater affinity for somatostatin-14 than -28. [provided by RefSeq, Jul 2012]
Mouse(20605) somatostatin receptor 1
Rat(25033) somatostatin receptor 1
cow(540013) somatostatin receptor 1
naked mole-rat(101712120) somatostatin receptor 1
domestic guinea pig(100462898) somatostatin receptor 1
domestic guinea pig(100731850) somatostatin receptor 1
chicken(771648) somatostatin receptor 1
domestic cat(101093025) somatostatin receptor 1
Horse(100060276) somatostatin receptor 1
dog(403455) somatostatin receptor 1
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009216 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009216 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009216 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001049 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001049 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001049 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001049 Rosetta Predictions human pricing
NM_012719 Rosetta Predictions rat pricing
XM_579345 Rosetta Predictions rat pricing
NM_009216 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116640 predicted 2157
2 SASI_Hs01_00116641 predicted 1953
3 SASI_Hs01_00116642 predicted 1983
4 SASI_Hs01_00116643 predicted 1942
5 SASI_Hs01_00116644 predicted 893
6 SASI_Hs01_00116645 predicted 2146
7 SASI_Hs01_00116646 predicted 1937
8 SASI_Hs01_00116647 predicted 1409
9 SASI_Hs01_00116648 predicted 1992
10 SASI_Hs01_00116649 predicted 1682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012719 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055580 predicted 1496
2 SASI_Rn01_00055581 predicted 411
3 SASI_Rn01_00055583 predicted 1309
4 SASI_Rn01_00055584 predicted 1604
5 SASI_Rn02_00260056 predicted 414
6 SASI_Rn01_00055585 predicted 1449
7 SASI_Rn01_00055586 predicted 998
8 SASI_Rn02_00260057 predicted 1449
9 SASI_Rn01_00055587 predicted 943
10 SASI_Rn01_00055588 predicted 951
11 SASI_Rn01_00055582 predicted 1619
12 SASI_Rn01_00055589 predicted 1474
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579345 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00163039 predicted 265
2 SASI_Rn01_00163040 predicted 805
3 SASI_Rn01_00163041 predicted 590
4 SASI_Rn01_00163042 predicted 862
5 SASI_Rn01_00163043 predicted 657
6 SASI_Rn01_00163044 predicted 425
7 SASI_Rn01_00163045 predicted 1462
8 SASI_Rn01_00163046 predicted 1317
9 SASI_Rn01_00163047 predicted 1232
10 SASI_Rn01_00163048 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009216 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315626 predicted 1079
2 SASI_Mm02_00315627 predicted 862
3 SASI_Mm01_00030261 predicted 1445
4 SASI_Mm02_00315628 predicted 930
5 SASI_Mm02_00315629 predicted 663
6 SASI_Mm01_00030263 predicted 732
7 SASI_Mm02_00315630 predicted 1141
8 SASI_Mm02_00315631 predicted 634
9 SASI_Mm02_00315632 predicted 1081
10 SASI_Mm02_00315633 predicted 1501
11 SASI_Mm01_00030262 predicted 697
12 SASI_Mm01_00030264 predicted 1795
13 SASI_Mm01_00030265 predicted 1152
14 SASI_Mm01_00030266 predicted 1136
15 SASI_Mm01_00030267 predicted 1791
16 SASI_Mm01_00030268 predicted 1221
17 SASI_Mm01_00030269 predicted 1788
18 SASI_Mm01_00030270 predicted 1777
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009216
SSTR1 MISSION shRNA Bacterial Glycerol Stock
somatostatin receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009216.2-559s1c1
Sequence:CCGGCTTCCCAGAATGGGACCTTAACTCGAGTTAAGGTCCCATTCTGGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009216.2-1145s1c1
Sequence:CCGGCCTGTGTTATGTGCTCATCATCTCGAGATGATGAGCACATAACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009216.2-699s1c1
Sequence:CCGGGCTACCAACATCTACATTCTACTCGAGTAGAATGTAGATGTTGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009216.2-754s1c1
Sequence:CCGGGCGTGCCCTTTCTGGTCACTTCTCGAGAAGTGACCAGAAAGGGCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009216.2-974s1c1
Sequence:CCGGCCTGTCATTACTGGTTATCTTCTCGAGAAGATAACCAGTAATGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009216
SSTR1 MISSION shRNA shRNA Plasmid DNA
somatostatin receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009216.2-559s1c1
Sequence:CCGGCTTCCCAGAATGGGACCTTAACTCGAGTTAAGGTCCCATTCTGGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009216.2-1145s1c1
Sequence:CCGGCCTGTGTTATGTGCTCATCATCTCGAGATGATGAGCACATAACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009216.2-699s1c1
Sequence:CCGGGCTACCAACATCTACATTCTACTCGAGTAGAATGTAGATGTTGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009216.2-754s1c1
Sequence:CCGGGCGTGCCCTTTCTGGTCACTTCTCGAGAAGTGACCAGAAAGGGCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009216.2-974s1c1
Sequence:CCGGCCTGTCATTACTGGTTATCTTCTCGAGAAGATAACCAGTAATGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009216
SSTR1 MISSION shRNA Lentiviral Transduction Particles
somatostatin receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009216.2-559s1c1
Sequence:CCGGCTTCCCAGAATGGGACCTTAACTCGAGTTAAGGTCCCATTCTGGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009216.2-1145s1c1
Sequence:CCGGCCTGTGTTATGTGCTCATCATCTCGAGATGATGAGCACATAACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009216.2-699s1c1
Sequence:CCGGGCTACCAACATCTACATTCTACTCGAGTAGAATGTAGATGTTGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009216.2-754s1c1
Sequence:CCGGGCGTGCCCTTTCTGGTCACTTCTCGAGAAGTGACCAGAAAGGGCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009216.2-974s1c1
Sequence:CCGGCCTGTCATTACTGGTTATCTTCTCGAGAAGATAACCAGTAATGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001049
SSTR1 MISSION shRNA Bacterial Glycerol Stock
somatostatin receptor 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001049.2-788s1c1
Sequence:CCGGCGCCATCCTGATCTCTTTCATCTCGAGATGAAAGAGATCAGGATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001049.2-1421s1c1
Sequence:CCGGGATCACCTTAATGGTGATGATCTCGAGATCATCACCATTAAGGTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001049.2-892s1c1
Sequence:CCGGCCACCAACATCTACATCCTAACTCGAGTTAGGATGTAGATGTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001049.2-1612s1c1
Sequence:CCGGGCTCTTTCCAACGCATCCTATCTCGAGATAGGATGCGTTGGAAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001049.2-3002s1c1
Sequence:CCGGGCGGTGCCTAAGAAGTTATTTCTCGAGAAATAACTTCTTAGGCACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001049.2-1130s21c1
Sequence:CCGGCACCGTGGCCAAGGTAGTAAACTCGAGTTTACTACCTTGGCCACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001049.2-1599s21c1
Sequence:CCGGGACAACTTCAAGCGCTCTTTCCTCGAGGAAAGAGCGCTTGAAGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001049.2-2155s21c1
Sequence:CCGGGAACTCATTAACAACTCATTCCTCGAGGAATGAGTTGTTAATGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001049.2-1339s21c1
Sequence:CCGGTGTGCTACGTGCTCATCATTGCTCGAGCAATGATGAGCACGTAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001049.2-894s21c1
Sequence:CCGGACCAACATCTACATCCTAAATCTCGAGATTTAGGATGTAGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001049.2-1412s21c1
Sequence:CCGGGGAGCGCAAGATCACCTTAATCTCGAGATTAAGGTGATCTTGCGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001049.2-1988s21c1
Sequence:CCGGAGTGAGAGCTTTGCTTATAAACTCGAGTTTATAAGCAAAGCTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001049
SSTR1 MISSION shRNA shRNA Plasmid DNA
somatostatin receptor 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001049.2-788s1c1
Sequence:CCGGCGCCATCCTGATCTCTTTCATCTCGAGATGAAAGAGATCAGGATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001049.2-1421s1c1
Sequence:CCGGGATCACCTTAATGGTGATGATCTCGAGATCATCACCATTAAGGTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001049.2-892s1c1
Sequence:CCGGCCACCAACATCTACATCCTAACTCGAGTTAGGATGTAGATGTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001049.2-1612s1c1
Sequence:CCGGGCTCTTTCCAACGCATCCTATCTCGAGATAGGATGCGTTGGAAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001049.2-3002s1c1
Sequence:CCGGGCGGTGCCTAAGAAGTTATTTCTCGAGAAATAACTTCTTAGGCACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001049.2-1130s21c1
Sequence:CCGGCACCGTGGCCAAGGTAGTAAACTCGAGTTTACTACCTTGGCCACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001049.2-1599s21c1
Sequence:CCGGGACAACTTCAAGCGCTCTTTCCTCGAGGAAAGAGCGCTTGAAGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001049.2-2155s21c1
Sequence:CCGGGAACTCATTAACAACTCATTCCTCGAGGAATGAGTTGTTAATGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001049.2-1339s21c1
Sequence:CCGGTGTGCTACGTGCTCATCATTGCTCGAGCAATGATGAGCACGTAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001049.2-894s21c1
Sequence:CCGGACCAACATCTACATCCTAAATCTCGAGATTTAGGATGTAGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001049.2-1412s21c1
Sequence:CCGGGGAGCGCAAGATCACCTTAATCTCGAGATTAAGGTGATCTTGCGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001049.2-1988s21c1
Sequence:CCGGAGTGAGAGCTTTGCTTATAAACTCGAGTTTATAAGCAAAGCTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001049
SSTR1 MISSION shRNA Lentiviral Transduction Particles
somatostatin receptor 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001049.2-788s1c1
Sequence:CCGGCGCCATCCTGATCTCTTTCATCTCGAGATGAAAGAGATCAGGATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001049.2-1421s1c1
Sequence:CCGGGATCACCTTAATGGTGATGATCTCGAGATCATCACCATTAAGGTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001049.2-892s1c1
Sequence:CCGGCCACCAACATCTACATCCTAACTCGAGTTAGGATGTAGATGTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001049.2-1612s1c1
Sequence:CCGGGCTCTTTCCAACGCATCCTATCTCGAGATAGGATGCGTTGGAAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001049.2-3002s1c1
Sequence:CCGGGCGGTGCCTAAGAAGTTATTTCTCGAGAAATAACTTCTTAGGCACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001049.2-1130s21c1
Sequence:CCGGCACCGTGGCCAAGGTAGTAAACTCGAGTTTACTACCTTGGCCACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001049.2-1599s21c1
Sequence:CCGGGACAACTTCAAGCGCTCTTTCCTCGAGGAAAGAGCGCTTGAAGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001049.2-2155s21c1
Sequence:CCGGGAACTCATTAACAACTCATTCCTCGAGGAATGAGTTGTTAATGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001049.2-1339s21c1
Sequence:CCGGTGTGCTACGTGCTCATCATTGCTCGAGCAATGATGAGCACGTAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001049.2-894s21c1
Sequence:CCGGACCAACATCTACATCCTAAATCTCGAGATTTAGGATGTAGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001049.2-1412s21c1
Sequence:CCGGGGAGCGCAAGATCACCTTAATCTCGAGATTAAGGTGATCTTGCGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001049.2-1988s21c1
Sequence:CCGGAGTGAGAGCTTTGCTTATAAACTCGAGTTTATAAGCAAAGCTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks