EMAIL THIS PAGE TO A FRIEND

SSTR2

somatostatin receptor 2

UniProtKB ID: P30874, A8K3Y0, Q4VBP0, Q96GE0, Q96TF2, Q9BWH1
Gene ID:
Human(6752) Summary: Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR2 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in cerebrum and kidney. [provided by RefSeq, Jul 2008]
Mouse(20606) somatostatin receptor 2
Rat(54305) somatostatin receptor 2
chicken(395305) somatostatin receptor 2
domestic cat(101090974) somatostatin receptor 2
dog(403472) somatostatin receptor 2
domestic guinea pig(100723875) somatostatin receptor 2
domestic guinea pig(100462899) somatostatin receptor 2
naked mole-rat(101716788) somatostatin receptor 2
Domestic Rabbit(100356395) somatostatin receptor 2
cow(282083) somatostatin receptor 2
sheep(443137) somatostatin receptor 2
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001050 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001050 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001050 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009217 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009217 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009217 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001050 Rosetta Predictions human pricing
NM_019348 Rosetta Predictions rat pricing
NM_001042606 Rosetta Predictions mouse pricing
NM_009217 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117218 predicted 1443
2 SASI_Hs01_00117219 predicted 1392
3 SASI_Hs01_00117220 predicted 932
4 SASI_Hs01_00117221 predicted 1021
5 SASI_Hs01_00117222 predicted 693
6 SASI_Hs01_00117223 predicted 1033
7 SASI_Hs01_00117225 predicted 958
8 SASI_Hs01_00117226 predicted 521
9 SASI_Hs02_00311852 predicted 1220
10 SASI_Hs01_00117227 predicted 758
11 SASI_Hs01_00117224 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019348 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039012 predicted 968
2 SASI_Rn01_00039013 predicted 1399
3 SASI_Rn01_00039014 predicted 1251
4 SASI_Rn01_00039016 predicted 1455
5 SASI_Rn01_00039017 predicted 1800
6 SASI_Rn01_00039018 predicted 403
7 SASI_Rn01_00039019 predicted 1598
8 SASI_Rn02_00262350 predicted 1025
9 SASI_Rn01_00039020 predicted 762
10 SASI_Rn01_00039021 predicted 712
11 SASI_Rn01_00039015 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290695 predicted 355
2 SASI_Mm02_00290696 predicted 721
3 SASI_Mm02_00290697 predicted 336
4 SASI_Mm02_00290698 predicted 619
5 SASI_Mm02_00290699 predicted 476
6 SASI_Mm02_00290700 predicted 700
7 SASI_Mm02_00290701 predicted 251
8 SASI_Mm02_00290702 predicted 609
9 SASI_Mm02_00290703 predicted 607
10 SASI_Mm02_00290704 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162767 predicted 350
2 SASI_Mm02_00315634 predicted 714
3 SASI_Mm02_00315635 predicted 337
4 SASI_Mm02_00315636 predicted 616
5 SASI_Mm02_00315637 predicted 485
6 SASI_Mm01_00162770 predicted 695
7 SASI_Mm01_00162772 predicted 247
8 SASI_Mm01_00162773 predicted 608
9 SASI_Mm02_00315638 predicted 601
10 SASI_Mm02_00315639 predicted 658
11 SASI_Mm01_00162768 predicted 1071
12 SASI_Mm01_00162769 predicted 630
13 SASI_Mm01_00162771 predicted 1079
14 SASI_Mm01_00162774 predicted 1612
15 SASI_Mm01_00162775 predicted 772
16 SASI_Mm01_00162776 predicted 1404
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001050
SSTR2 MISSION shRNA Bacterial Glycerol Stock
somatostatin receptor 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001050.2-581s21c1
Sequence:CCGGTGAAGACCATCACCAACATTTCTCGAGAAATGTTGGTGATGGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001050.2-880s21c1
Sequence:CCGGATCTTGCCCATCATGATATATCTCGAGATATATCATGATGGGCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001050.2-1892s21c1
Sequence:CCGGCAAGTAGCAAATTCGAGTATGCTCGAGCATACTCGAATTTGCTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001050.2-1937s21c1
Sequence:CCGGCAACACACTGCCCGCAGAAATCTCGAGATTTCTGCGGGCAGTGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001050.2-490s1c1
Sequence:CCGGGCAGTCCTCACATTCATCTATCTCGAGATAGATGAATGTGAGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001050.2-1171s1c1
Sequence:CCGGCCCTTCTACATATTCAACGTTCTCGAGAACGTTGAATATGTAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001050.2-1284s1c1
Sequence:CCGGCCCTATCCTATATGCCTTCTTCTCGAGAAGAAGGCATATAGGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001050.2-1730s1c1
Sequence:CCGGCCTGGATATGATCTTTAGAAACTCGAGTTTCTAAAGATCATATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001050.2-1222s1c1
Sequence:CCGGCCAGCCCTTAAAGGCATGTTTCTCGAGAAACATGCCTTTAAGGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001050
SSTR2 MISSION shRNA shRNA Plasmid DNA
somatostatin receptor 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001050.2-581s21c1
Sequence:CCGGTGAAGACCATCACCAACATTTCTCGAGAAATGTTGGTGATGGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001050.2-880s21c1
Sequence:CCGGATCTTGCCCATCATGATATATCTCGAGATATATCATGATGGGCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001050.2-1892s21c1
Sequence:CCGGCAAGTAGCAAATTCGAGTATGCTCGAGCATACTCGAATTTGCTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001050.2-1937s21c1
Sequence:CCGGCAACACACTGCCCGCAGAAATCTCGAGATTTCTGCGGGCAGTGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001050.2-490s1c1
Sequence:CCGGGCAGTCCTCACATTCATCTATCTCGAGATAGATGAATGTGAGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001050.2-1171s1c1
Sequence:CCGGCCCTTCTACATATTCAACGTTCTCGAGAACGTTGAATATGTAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001050.2-1284s1c1
Sequence:CCGGCCCTATCCTATATGCCTTCTTCTCGAGAAGAAGGCATATAGGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001050.2-1730s1c1
Sequence:CCGGCCTGGATATGATCTTTAGAAACTCGAGTTTCTAAAGATCATATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001050.2-1222s1c1
Sequence:CCGGCCAGCCCTTAAAGGCATGTTTCTCGAGAAACATGCCTTTAAGGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001050
SSTR2 MISSION shRNA Lentiviral Transduction Particles
somatostatin receptor 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001050.2-581s21c1
Sequence:CCGGTGAAGACCATCACCAACATTTCTCGAGAAATGTTGGTGATGGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001050.2-880s21c1
Sequence:CCGGATCTTGCCCATCATGATATATCTCGAGATATATCATGATGGGCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001050.2-1892s21c1
Sequence:CCGGCAAGTAGCAAATTCGAGTATGCTCGAGCATACTCGAATTTGCTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001050.2-1937s21c1
Sequence:CCGGCAACACACTGCCCGCAGAAATCTCGAGATTTCTGCGGGCAGTGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001050.2-490s1c1
Sequence:CCGGGCAGTCCTCACATTCATCTATCTCGAGATAGATGAATGTGAGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001050.2-1171s1c1
Sequence:CCGGCCCTTCTACATATTCAACGTTCTCGAGAACGTTGAATATGTAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001050.2-1284s1c1
Sequence:CCGGCCCTATCCTATATGCCTTCTTCTCGAGAAGAAGGCATATAGGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001050.2-1730s1c1
Sequence:CCGGCCTGGATATGATCTTTAGAAACTCGAGTTTCTAAAGATCATATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001050.2-1222s1c1
Sequence:CCGGCCAGCCCTTAAAGGCATGTTTCTCGAGAAACATGCCTTTAAGGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009217
SSTR2 MISSION shRNA Bacterial Glycerol Stock
somatostatin receptor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009217.1-1203s1c1
Sequence:CCGGCGTGGTACACAGGTTTCATTACTCGAGTAATGAAACCTGTGTACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009217.1-1462s1c1
Sequence:CCGGCCTGAAAGGAATGTTTGACTTCTCGAGAAGTCAAACATTCCTTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009217.1-1578s1c1
Sequence:CCGGGCTTGGTCAAGGCAGACAATTCTCGAGAATTGTCTGCCTTGACCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009217.1-853s1c1
Sequence:CCGGCATTGCAGATGAACTCTTCATCTCGAGATGAAGAGTTCATCTGCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009217.1-727s1c1
Sequence:CCGGCGTCCTCACGTTCATCTACTTCTCGAGAAGTAGATGAACGTGAGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009217
SSTR2 MISSION shRNA shRNA Plasmid DNA
somatostatin receptor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009217.1-1203s1c1
Sequence:CCGGCGTGGTACACAGGTTTCATTACTCGAGTAATGAAACCTGTGTACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009217.1-1462s1c1
Sequence:CCGGCCTGAAAGGAATGTTTGACTTCTCGAGAAGTCAAACATTCCTTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009217.1-1578s1c1
Sequence:CCGGGCTTGGTCAAGGCAGACAATTCTCGAGAATTGTCTGCCTTGACCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009217.1-853s1c1
Sequence:CCGGCATTGCAGATGAACTCTTCATCTCGAGATGAAGAGTTCATCTGCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009217.1-727s1c1
Sequence:CCGGCGTCCTCACGTTCATCTACTTCTCGAGAAGTAGATGAACGTGAGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009217
SSTR2 MISSION shRNA Lentiviral Transduction Particles
somatostatin receptor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009217.1-1203s1c1
Sequence:CCGGCGTGGTACACAGGTTTCATTACTCGAGTAATGAAACCTGTGTACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009217.1-1462s1c1
Sequence:CCGGCCTGAAAGGAATGTTTGACTTCTCGAGAAGTCAAACATTCCTTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009217.1-1578s1c1
Sequence:CCGGGCTTGGTCAAGGCAGACAATTCTCGAGAATTGTCTGCCTTGACCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009217.1-853s1c1
Sequence:CCGGCATTGCAGATGAACTCTTCATCTCGAGATGAAGAGTTCATCTGCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009217.1-727s1c1
Sequence:CCGGCGTCCTCACGTTCATCTACTTCTCGAGAAGTAGATGAACGTGAGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks