EMAIL THIS PAGE TO A FRIEND

SSTR3

somatostatin receptor 3

Synonyms: SS-3-R SS3-R SS3R SSR-28
UniProtKB ID: P32745, A8K550, Q53ZR7
Gene ID:
Human(6753) Summary: This gene encodes a member of the somatostatin receptor protein family. Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This protein is functionally coupled to adenylyl cyclase. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(20607) somatostatin receptor 3
Rat(171044) somatostatin receptor 3
cow(518585) somatostatin receptor 3
sheep(101103055) somatostatin receptor 3
naked mole-rat(101725637) somatostatin receptor 3
domestic guinea pig(100731199) somatostatin receptor 3
Zebrafish(566989) somatostatin receptor 3
domestic cat(101096494) somatostatin receptor 3
dog(481272) somatostatin receptor 3
chicken(427907) somatostatin receptor 3
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009218 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009218 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009218 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001051 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001051 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001051 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU157381 MISSION® esiRNA esiRNA targeting mouse Sstr3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001051 Rosetta Predictions human pricing
NM_133522 Rosetta Predictions rat pricing
NM_009218 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001051 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051078 predicted 826
2 SASI_Hs01_00051079 predicted 1076
3 SASI_Hs01_00051080 predicted 938
4 SASI_Hs01_00051081 predicted 743
5 SASI_Hs01_00051082 predicted 611
6 SASI_Hs01_00051083 predicted 1075
7 SASI_Hs01_00051085 predicted 550
8 SASI_Hs01_00051086 predicted 1753
9 SASI_Hs01_00051087 predicted 1392
10 SASI_Hs02_00311853 predicted 1390
11 SASI_Hs01_00051084 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133522 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267701 predicted 2249
2 SASI_Rn01_00111389 predicted 915
3 SASI_Rn02_00267702 predicted 1479
4 SASI_Rn01_00111390 predicted 1323
5 SASI_Rn01_00111391 predicted 2257
6 SASI_Rn01_00111392 predicted 2096
7 SASI_Rn01_00111394 predicted 692
8 SASI_Rn01_00111397 predicted 658
9 SASI_Rn01_00111398 predicted 753
10 SASI_Rn02_00267703 predicted 1999
11 SASI_Rn01_00111393 predicted 2280
12 SASI_Rn01_00111395 predicted 1270
13 SASI_Rn01_00111396 predicted 886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009218 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112514 predicted 1234
2 SASI_Mm01_00112515 predicted 1065
3 SASI_Mm01_00112516 predicted 2157
4 SASI_Mm01_00112517 predicted 2067
5 SASI_Mm01_00112518 predicted 2108
6 SASI_Mm01_00112519 predicted 1774
7 SASI_Mm01_00112520 predicted 2025
8 SASI_Mm01_00112521 predicted 1837
9 SASI_Mm01_00112522 predicted 2167
10 SASI_Mm01_00112523 predicted 2061
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009218
SSTR3 MISSION shRNA Bacterial Glycerol Stock
somatostatin receptor 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009218.1-1012s1c1
Sequence:CCGGCTAAGACCATCACGTCGCATTCTCGAGAATGCGACGTGATGGTCTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009218.1-676s1c1
Sequence:CCGGTGCTACTTGCTCATTGTGGTACTCGAGTACCACAATGAGCAAGTAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009218.1-378s1c1
Sequence:CCGGCAACCAGTTCACCAGCATCTTCTCGAGAAGATGCTGGTGAACTGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009218.1-237s1c1
Sequence:CCGGGACCAGTGTCTATATCCTCAACTCGAGTTGAGGATATAGACACTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009218.1-840s1c1
Sequence:CCGGGCCTTTCTATCTGCTCAACATCTCGAGATGTTGAGCAGATAGAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000453053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009218.3-1665s21c1
Sequence:CCGGGCACACTGAGCCATCTGTAAGCTCGAGCTTACAGATGGCTCAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000451949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009218.3-1946s21c1
Sequence:CCGGGACTCAGGGATGGGTAAACTGCTCGAGCAGTTTACCCATCCCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009218
SSTR3 MISSION shRNA shRNA Plasmid DNA
somatostatin receptor 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009218.1-1012s1c1
Sequence:CCGGCTAAGACCATCACGTCGCATTCTCGAGAATGCGACGTGATGGTCTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009218.1-676s1c1
Sequence:CCGGTGCTACTTGCTCATTGTGGTACTCGAGTACCACAATGAGCAAGTAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009218.1-378s1c1
Sequence:CCGGCAACCAGTTCACCAGCATCTTCTCGAGAAGATGCTGGTGAACTGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009218.1-237s1c1
Sequence:CCGGGACCAGTGTCTATATCCTCAACTCGAGTTGAGGATATAGACACTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009218.1-840s1c1
Sequence:CCGGGCCTTTCTATCTGCTCAACATCTCGAGATGTTGAGCAGATAGAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000453053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009218.3-1665s21c1
Sequence:CCGGGCACACTGAGCCATCTGTAAGCTCGAGCTTACAGATGGCTCAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000451949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009218.3-1946s21c1
Sequence:CCGGGACTCAGGGATGGGTAAACTGCTCGAGCAGTTTACCCATCCCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009218
SSTR3 MISSION shRNA Lentiviral Transduction Particles
somatostatin receptor 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009218.1-1012s1c1
Sequence:CCGGCTAAGACCATCACGTCGCATTCTCGAGAATGCGACGTGATGGTCTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009218.1-676s1c1
Sequence:CCGGTGCTACTTGCTCATTGTGGTACTCGAGTACCACAATGAGCAAGTAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009218.1-378s1c1
Sequence:CCGGCAACCAGTTCACCAGCATCTTCTCGAGAAGATGCTGGTGAACTGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009218.1-237s1c1
Sequence:CCGGGACCAGTGTCTATATCCTCAACTCGAGTTGAGGATATAGACACTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009218.1-840s1c1
Sequence:CCGGGCCTTTCTATCTGCTCAACATCTCGAGATGTTGAGCAGATAGAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000453053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009218.3-1665s21c1
Sequence:CCGGGCACACTGAGCCATCTGTAAGCTCGAGCTTACAGATGGCTCAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000451949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009218.3-1946s21c1
Sequence:CCGGGACTCAGGGATGGGTAAACTGCTCGAGCAGTTTACCCATCCCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001051
SSTR3 MISSION shRNA Bacterial Glycerol Stock
somatostatin receptor 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001051.2-1389s1c1
Sequence:CCGGGCCTGCCTTCTTTGGGCTCTACTCGAGTAGAGCCCAAAGAAGGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001051.2-1944s1c1
Sequence:CCGGTCTACTCTCTGGGCCTTGTTTCTCGAGAAACAAGGCCCAGAGAGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001051.2-1338s1c1
Sequence:CCGGGCCCTTCTACGTGCTCAACATCTCGAGATGTTGAGCACGTAGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001051.2-556s1c1
Sequence:CCGGACGACCTCAGAACCTGAGAATCTCGAGATTCTCAGGTTCTGAGGTCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001051.2-1761s1c1
Sequence:CCGGGATGCGCATCAGCTACCTGTACTCGAGTACAGGTAGCTGATGCGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001051.2-1885s21c1
Sequence:CCGGGGCCTGGACTTTGATGCTATTCTCGAGAATAGCATCAAAGTCCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001051.2-753s21c1
Sequence:CCGGTTCAGTCACCAACGTCTACATCTCGAGATGTAGACGTTGGTGACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001051.2-1934s21c1
Sequence:CCGGGTAGGTTGCTTCTACTCTCTGCTCGAGCAGAGAGTAGAAGCAACCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001051.2-1337s21c1
Sequence:CCGGTGCCCTTCTACGTGCTCAACACTCGAGTGTTGAGCACGTAGAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001051
SSTR3 MISSION shRNA shRNA Plasmid DNA
somatostatin receptor 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001051.2-1389s1c1
Sequence:CCGGGCCTGCCTTCTTTGGGCTCTACTCGAGTAGAGCCCAAAGAAGGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001051.2-1944s1c1
Sequence:CCGGTCTACTCTCTGGGCCTTGTTTCTCGAGAAACAAGGCCCAGAGAGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001051.2-1338s1c1
Sequence:CCGGGCCCTTCTACGTGCTCAACATCTCGAGATGTTGAGCACGTAGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001051.2-556s1c1
Sequence:CCGGACGACCTCAGAACCTGAGAATCTCGAGATTCTCAGGTTCTGAGGTCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001051.2-1761s1c1
Sequence:CCGGGATGCGCATCAGCTACCTGTACTCGAGTACAGGTAGCTGATGCGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001051.2-1885s21c1
Sequence:CCGGGGCCTGGACTTTGATGCTATTCTCGAGAATAGCATCAAAGTCCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001051.2-753s21c1
Sequence:CCGGTTCAGTCACCAACGTCTACATCTCGAGATGTAGACGTTGGTGACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001051.2-1934s21c1
Sequence:CCGGGTAGGTTGCTTCTACTCTCTGCTCGAGCAGAGAGTAGAAGCAACCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001051.2-1337s21c1
Sequence:CCGGTGCCCTTCTACGTGCTCAACACTCGAGTGTTGAGCACGTAGAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001051
SSTR3 MISSION shRNA Lentiviral Transduction Particles
somatostatin receptor 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001051.2-1389s1c1
Sequence:CCGGGCCTGCCTTCTTTGGGCTCTACTCGAGTAGAGCCCAAAGAAGGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001051.2-1944s1c1
Sequence:CCGGTCTACTCTCTGGGCCTTGTTTCTCGAGAAACAAGGCCCAGAGAGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001051.2-1338s1c1
Sequence:CCGGGCCCTTCTACGTGCTCAACATCTCGAGATGTTGAGCACGTAGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001051.2-556s1c1
Sequence:CCGGACGACCTCAGAACCTGAGAATCTCGAGATTCTCAGGTTCTGAGGTCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001051.2-1761s1c1
Sequence:CCGGGATGCGCATCAGCTACCTGTACTCGAGTACAGGTAGCTGATGCGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001051.2-1885s21c1
Sequence:CCGGGGCCTGGACTTTGATGCTATTCTCGAGAATAGCATCAAAGTCCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001051.2-753s21c1
Sequence:CCGGTTCAGTCACCAACGTCTACATCTCGAGATGTAGACGTTGGTGACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001051.2-1934s21c1
Sequence:CCGGGTAGGTTGCTTCTACTCTCTGCTCGAGCAGAGAGTAGAAGCAACCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001051.2-1337s21c1
Sequence:CCGGTGCCCTTCTACGTGCTCAACACTCGAGTGTTGAGCACGTAGAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks