EMAIL THIS PAGE TO A FRIEND

SSTR4

somatostatin receptor 4

Synonyms: SS-4-R SS4-R SS4R
UniProtKB ID: P31391, Q17RM1, Q17RM3, Q9UIY1
Gene ID:
Human(6754) Summary: Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR4 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in fetal and adult brain and lung. [provided by RefSeq, Jul 2008]
Mouse(20608) somatostatin receptor 4
Rat(25555) somatostatin receptor 4
chicken(428547) somatostatin receptor 4
Horse(100049965) somatostatin receptor 4
domestic cat(101086552) somatostatin receptor 4
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009219 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009219 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009219 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001052 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001052 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001052 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU061591 MISSION® esiRNA esiRNA targeting mouse Sstr4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001052 Rosetta Predictions human pricing
NM_013036 Rosetta Predictions rat pricing
NM_009219 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001052 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311854 predicted 1003
2 SASI_Hs01_00159164 predicted 690
3 SASI_Hs01_00159166 predicted 934
4 SASI_Hs02_00311855 predicted 939
5 SASI_Hs01_00159165 predicted 915
6 SASI_Hs01_00159167 predicted 685
7 SASI_Hs01_00159168 predicted 936
8 SASI_Hs02_00311856 predicted 1013
9 SASI_Hs01_00159170 predicted 462
10 SASI_Hs02_00311857 predicted 932
11 SASI_Hs01_00159163 predicted 885
12 SASI_Hs01_00159169 predicted 626
13 SASI_Hs01_00159171 predicted 941
14 SASI_Hs01_00159172 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013036 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053663 predicted 320
2 SASI_Rn01_00053664 predicted 724
3 SASI_Rn01_00053665 predicted 1308
4 SASI_Rn01_00053666 predicted 257
5 SASI_Rn01_00053669 predicted 911
6 SASI_Rn01_00053670 predicted 670
7 SASI_Rn01_00053671 predicted 1081
8 SASI_Rn02_00260741 predicted 223
9 SASI_Rn01_00053672 predicted 1296
10 SASI_Rn02_00260742 predicted 1446
11 SASI_Rn01_00053667 predicted 739
12 SASI_Rn01_00053668 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009219 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315640 predicted 989
2 SASI_Mm02_00315641 predicted 966
3 SASI_Mm01_00078643 predicted 224
4 SASI_Mm02_00315642 predicted 759
5 SASI_Mm02_00315643 predicted 317
6 SASI_Mm02_00315644 predicted 431
7 SASI_Mm02_00315645 predicted 1113
8 SASI_Mm01_00078645 predicted 954
9 SASI_Mm02_00315646 predicted 583
10 SASI_Mm02_00315647 predicted 746
11 SASI_Mm01_00078641 predicted 1583
12 SASI_Mm01_00078642 predicted 1689
13 SASI_Mm01_00078644 predicted 804
14 SASI_Mm01_00078646 predicted 1690
15 SASI_Mm01_00078647 predicted 1649
16 SASI_Mm01_00078648 predicted 1459
17 SASI_Mm01_00078649 predicted 367
18 SASI_Mm01_00078650 predicted 1260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009219
SSTR4 MISSION shRNA Bacterial Glycerol Stock
somatostatin receptor 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009219.3-854s21c1
Sequence:CCGGATCACTAGGCTCGTGCTAATGCTCGAGCATTAGCACGAGCCTAGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009219.3-1228s21c1
Sequence:CCGGTTTCACCAAGACCACTACTTTCTCGAGAAAGTAGTGGTCTTGGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009219.1-681s1c1
Sequence:CCGGCCTGCTTATTGTGGGCAAGATCTCGAGATCTTGCCCACAATAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009219.1-808s1c1
Sequence:CCGGCCTTTCTATGTGGTGCAGCTTCTCGAGAAGCTGCACCACATAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009219.1-669s1c1
Sequence:CCGGCGGATTATGCTACCTGCTTATCTCGAGATAAGCAGGTAGCATAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009219.1-187s1c1
Sequence:CCGGCTGGTCATCTTCGTGATCCTACTCGAGTAGGATCACGAAGATGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009219.1-611s1c1
Sequence:CCGGCTGCGGTCTTTGTGATCTATACTCGAGTATAGATCACAAAGACCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009219
SSTR4 MISSION shRNA shRNA Plasmid DNA
somatostatin receptor 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009219.3-854s21c1
Sequence:CCGGATCACTAGGCTCGTGCTAATGCTCGAGCATTAGCACGAGCCTAGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009219.3-1228s21c1
Sequence:CCGGTTTCACCAAGACCACTACTTTCTCGAGAAAGTAGTGGTCTTGGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009219.1-681s1c1
Sequence:CCGGCCTGCTTATTGTGGGCAAGATCTCGAGATCTTGCCCACAATAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009219.1-808s1c1
Sequence:CCGGCCTTTCTATGTGGTGCAGCTTCTCGAGAAGCTGCACCACATAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009219.1-669s1c1
Sequence:CCGGCGGATTATGCTACCTGCTTATCTCGAGATAAGCAGGTAGCATAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009219.1-187s1c1
Sequence:CCGGCTGGTCATCTTCGTGATCCTACTCGAGTAGGATCACGAAGATGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009219.1-611s1c1
Sequence:CCGGCTGCGGTCTTTGTGATCTATACTCGAGTATAGATCACAAAGACCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009219
SSTR4 MISSION shRNA Lentiviral Transduction Particles
somatostatin receptor 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009219.3-854s21c1
Sequence:CCGGATCACTAGGCTCGTGCTAATGCTCGAGCATTAGCACGAGCCTAGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009219.3-1228s21c1
Sequence:CCGGTTTCACCAAGACCACTACTTTCTCGAGAAAGTAGTGGTCTTGGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009219.1-681s1c1
Sequence:CCGGCCTGCTTATTGTGGGCAAGATCTCGAGATCTTGCCCACAATAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009219.1-808s1c1
Sequence:CCGGCCTTTCTATGTGGTGCAGCTTCTCGAGAAGCTGCACCACATAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009219.1-669s1c1
Sequence:CCGGCGGATTATGCTACCTGCTTATCTCGAGATAAGCAGGTAGCATAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009219.1-187s1c1
Sequence:CCGGCTGGTCATCTTCGTGATCCTACTCGAGTAGGATCACGAAGATGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009219.1-611s1c1
Sequence:CCGGCTGCGGTCTTTGTGATCTATACTCGAGTATAGATCACAAAGACCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001052
SSTR4 MISSION shRNA Bacterial Glycerol Stock
somatostatin receptor 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001052.2-692s21c1
Sequence:CCGGGTCTTCGTGGTCTACACTTTCCTCGAGGAAAGTGTAGACCACGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001052.2-937s21c1
Sequence:CCGGCGTCAACCACGTGTCCCTTATCTCGAGATAAGGGACACGTGGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001052.2-1009s21c1
Sequence:CCGGCGACAACTTCCGCCGATTCTTCTCGAGAAGAATCGGCGGAAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001052.1-138s1c1
Sequence:CCGGCATGGTCGCTATCCAGTGCATCTCGAGATGCACTGGATAGCGACCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001052.1-621s1c1
Sequence:CCGGGTCGGCAGTCTTCGTGGTCTACTCGAGTAGACCACGAAGACTGCCGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001052.1-955s1c1
Sequence:CCGGCGCCGATCCTTCCAGCGGGTTCTCGAGAACCCGCTGGAAGGATCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001052.1-883s1c1
Sequence:CCGGGTGTCCCTTATCCTCAGCTATCTCGAGATAGCTGAGGATAAGGGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001052
SSTR4 MISSION shRNA shRNA Plasmid DNA
somatostatin receptor 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001052.2-692s21c1
Sequence:CCGGGTCTTCGTGGTCTACACTTTCCTCGAGGAAAGTGTAGACCACGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001052.2-937s21c1
Sequence:CCGGCGTCAACCACGTGTCCCTTATCTCGAGATAAGGGACACGTGGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001052.2-1009s21c1
Sequence:CCGGCGACAACTTCCGCCGATTCTTCTCGAGAAGAATCGGCGGAAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001052.1-138s1c1
Sequence:CCGGCATGGTCGCTATCCAGTGCATCTCGAGATGCACTGGATAGCGACCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001052.1-621s1c1
Sequence:CCGGGTCGGCAGTCTTCGTGGTCTACTCGAGTAGACCACGAAGACTGCCGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001052.1-955s1c1
Sequence:CCGGCGCCGATCCTTCCAGCGGGTTCTCGAGAACCCGCTGGAAGGATCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001052.1-883s1c1
Sequence:CCGGGTGTCCCTTATCCTCAGCTATCTCGAGATAGCTGAGGATAAGGGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001052
SSTR4 MISSION shRNA Lentiviral Transduction Particles
somatostatin receptor 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001052.2-692s21c1
Sequence:CCGGGTCTTCGTGGTCTACACTTTCCTCGAGGAAAGTGTAGACCACGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001052.2-937s21c1
Sequence:CCGGCGTCAACCACGTGTCCCTTATCTCGAGATAAGGGACACGTGGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001052.2-1009s21c1
Sequence:CCGGCGACAACTTCCGCCGATTCTTCTCGAGAAGAATCGGCGGAAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001052.1-138s1c1
Sequence:CCGGCATGGTCGCTATCCAGTGCATCTCGAGATGCACTGGATAGCGACCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001052.1-621s1c1
Sequence:CCGGGTCGGCAGTCTTCGTGGTCTACTCGAGTAGACCACGAAGACTGCCGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001052.1-955s1c1
Sequence:CCGGCGCCGATCCTTCCAGCGGGTTCTCGAGAACCCGCTGGAAGGATCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001052.1-883s1c1
Sequence:CCGGGTGTCCCTTATCCTCAGCTATCTCGAGATAGCTGAGGATAAGGGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks