EMAIL THIS PAGE TO A FRIEND

SSTR5-AS1

SSTR5 antisense RNA 1

Species: Human SSTR5-AS1(146336)
Gene ID:
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182510 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182510 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182510 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182510 Rosetta Predictions human pricing
XR_040906 Rosetta Predictions human pricing
XR_040907 Rosetta Predictions human pricing
XR_040908 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201541 predicted 1301
2 SASI_Hs01_00201542 predicted 1125
3 SASI_Hs01_00201543 predicted 1491
4 SASI_Hs01_00201544 predicted 1332
5 SASI_Hs01_00201545 predicted 1298
6 SASI_Hs01_00201546 predicted 1134
7 SASI_Hs01_00201547 predicted 1498
8 SASI_Hs01_00201548 predicted 1058
9 SASI_Hs01_00201549 predicted 1316
10 SASI_Hs01_00201550 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523000 predicted 362
2 SASI_Hs02_00523001 predicted 516
3 SASI_Hs02_00523002 predicted 361
4 SASI_Hs02_00523003 predicted 333
5 SASI_Hs02_00523004 predicted 412
6 SASI_Hs02_00523005 predicted 597
7 SASI_Hs02_00523006 predicted 453
8 SASI_Hs02_00523007 predicted 412
9 SASI_Hs02_00523008 predicted 357
10 SASI_Hs02_00523009 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523010 predicted 363
2 SASI_Hs02_00523011 predicted 511
3 SASI_Hs02_00523012 predicted 356
4 SASI_Hs02_00523013 predicted 330
5 SASI_Hs02_00523014 predicted 412
6 SASI_Hs02_00523015 predicted 590
7 SASI_Hs02_00523016 predicted 456
8 SASI_Hs02_00523017 predicted 412
9 SASI_Hs02_00523018 predicted 362
10 SASI_Hs02_00523019 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523020 predicted 368
2 SASI_Hs02_00523021 predicted 518
3 SASI_Hs02_00523022 predicted 358
4 SASI_Hs02_00523023 predicted 328
5 SASI_Hs02_00523024 predicted 404
6 SASI_Hs02_00523025 predicted 592
7 SASI_Hs02_00523026 predicted 457
8 SASI_Hs02_00523027 predicted 409
9 SASI_Hs02_00523028 predicted 356
10 SASI_Hs02_00523029 predicted 683
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182510
SSTR5-AS1 MISSION shRNA Bacterial Glycerol Stock
SSTR5 antisense RNA 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168809    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182510.1-2691s1c1
Sequence:CCGGGAGGCTGAAATGTTTGCACTTCTCGAGAAGTGCAAACATTTCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168269    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182510.1-1928s1c1
Sequence:CCGGCAGAGCAGAATAGAGACAGATCTCGAGATCTGTCTCTATTCTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167836    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182510.1-2706s1c1
Sequence:CCGGGCACTTCACATTTCCACATTTCTCGAGAAATGTGGAAATGTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167658    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182510.1-2697s1c1
Sequence:CCGGGAAATGTTTGCACTTCACATTCTCGAGAATGTGAAGTGCAAACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168225    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182510.1-2208s1c1
Sequence:CCGGCCTCTCTCTTGTTGTGAGATACTCGAGTATCTCACAACAAGAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182510
SSTR5-AS1 MISSION shRNA shRNA Plasmid DNA
SSTR5 antisense RNA 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168809    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182510.1-2691s1c1
Sequence:CCGGGAGGCTGAAATGTTTGCACTTCTCGAGAAGTGCAAACATTTCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168269    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182510.1-1928s1c1
Sequence:CCGGCAGAGCAGAATAGAGACAGATCTCGAGATCTGTCTCTATTCTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167836    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182510.1-2706s1c1
Sequence:CCGGGCACTTCACATTTCCACATTTCTCGAGAAATGTGGAAATGTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167658    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182510.1-2697s1c1
Sequence:CCGGGAAATGTTTGCACTTCACATTCTCGAGAATGTGAAGTGCAAACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168225    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182510.1-2208s1c1
Sequence:CCGGCCTCTCTCTTGTTGTGAGATACTCGAGTATCTCACAACAAGAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182510
SSTR5-AS1 MISSION shRNA Lentiviral Transduction Particles
SSTR5 antisense RNA 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168809    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182510.1-2691s1c1
Sequence:CCGGGAGGCTGAAATGTTTGCACTTCTCGAGAAGTGCAAACATTTCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168269    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182510.1-1928s1c1
Sequence:CCGGCAGAGCAGAATAGAGACAGATCTCGAGATCTGTCTCTATTCTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167836    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182510.1-2706s1c1
Sequence:CCGGGCACTTCACATTTCCACATTTCTCGAGAAATGTGGAAATGTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167658    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182510.1-2697s1c1
Sequence:CCGGGAAATGTTTGCACTTCACATTCTCGAGAATGTGAAGTGCAAACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168225    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182510.1-2208s1c1
Sequence:CCGGCCTCTCTCTTGTTGTGAGATACTCGAGTATCTCACAACAAGAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks