EMAIL THIS PAGE TO A FRIEND

SSTR5

somatostatin receptor 5

Synonyms: SS-5-R
UniProtKB ID: P35346, P34988, Q541E0, Q9UJI5
Gene ID:
Human(6755) Summary: Somatostatin and its related peptide cortistatin exert multiple biological actions on normal and tumoral tissue targets by interacting with somatostatin receptors (SSTRs). The protein encoded by this gene is one of the SSTRs, which is a multi-pass membrane protein and belongs to the G-protein coupled receptor 1 family. The activity of this receptor is mediated by G proteins which inhibit adenylyl cyclase, and different regions of this receptor molecule are required for the activation of different signaling pathways. A mutation in this gene results in somatostatin analog resistance. Alternatively spliced transcript variants have been identified in this gene.[provided by RefSeq, Feb 2010]
Mouse(20609) somatostatin receptor 5
Rat(25354) somatostatin receptor 5
cow(510344) somatostatin receptor 5
domestic guinea pig(100719553) somatostatin receptor 5
naked mole-rat(101711932) somatostatin receptor 5
chicken(427667) somatostatin receptor 5
dog(403454) somatostatin receptor 5
domestic cat(101090317) somatostatin receptor 5
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001053 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001053 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001053 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_139909 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_139909 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_139909 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001053 Rosetta Predictions human pricing
NM_012882 Rosetta Predictions rat pricing
NM_011425 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222656 predicted 864
2 SASI_Hs01_00222657 predicted 787
3 SASI_Hs01_00222658 predicted 769
4 SASI_Hs01_00222659 predicted 286
5 SASI_Hs01_00222660 predicted 781
6 SASI_Hs01_00222661 predicted 216
7 SASI_Hs01_00222662 predicted 270
8 SASI_Hs01_00222663 predicted 372
9 SASI_Hs01_00222664 predicted 357
10 SASI_Hs01_00222665 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108844 predicted 988
2 SASI_Rn01_00108845 predicted 243
3 SASI_Rn01_00108847 predicted 980
4 SASI_Rn01_00108848 predicted 978
5 SASI_Rn01_00108849 predicted 654
6 SASI_Rn02_00260393 predicted 989
7 SASI_Rn01_00108850 predicted 194
8 SASI_Rn01_00108851 predicted 792
9 SASI_Rn01_00108853 predicted 395
10 SASI_Rn02_00260394 predicted 1110
11 SASI_Rn01_00108846 predicted 1019
12 SASI_Rn01_00108852 predicted 976
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011425 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160812 predicted 965
2 SASI_Mm01_00160813 predicted 479
3 SASI_Mm01_00160814 predicted 1397
4 SASI_Mm01_00160815 predicted 424
5 SASI_Mm02_00320645 predicted 1610
6 SASI_Mm01_00160817 predicted 679
7 SASI_Mm01_00160818 predicted 1492
8 SASI_Mm01_00160819 predicted 1615
9 SASI_Mm01_00160820 predicted 967
10 SASI_Mm01_00160821 predicted 1606
11 SASI_Mm01_00160816 predicted 527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001053
SSTR5 MISSION shRNA Bacterial Glycerol Stock
somatostatin receptor 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001053.1-219s1c1
Sequence:CCGGCGTCACCAACATCTACATTCTCTCGAGAGAATGTAGATGTTGGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001053.1-363s1c1
Sequence:CCGGCAACCAGTTCACCAGTGTCTTCTCGAGAAGACACTGGTGAACTGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001053.1-792s1c1
Sequence:CCGGCTTCACCGTCAACATCGTCAACTCGAGTTGACGATGTTGACGGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001053.1-849s1c1
Sequence:CCGGCGGCCTCTACTTCTTCGTGGTCTCGAGACCACGAAGAAGTAGAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001053.2-881s21c1
Sequence:CCGGTTCACCGTCAACATCGTCAACCTCGAGGTTGACGATGTTGACGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001053.2-306s21c1
Sequence:CCGGCCGTCACCAACATCTACATTCCTCGAGGAATGTAGATGTTGGTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001053.2-453s21c1
Sequence:CCGGACCAGTTCACCAGTGTCTTCTCTCGAGAGAAGACACTGGTGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001053.2-957s21c1
Sequence:CCGGTCATCCTCTCCTACGCCAACACTCGAGTGTTGGCGTAGGAGAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001053
SSTR5 MISSION shRNA shRNA Plasmid DNA
somatostatin receptor 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001053.1-219s1c1
Sequence:CCGGCGTCACCAACATCTACATTCTCTCGAGAGAATGTAGATGTTGGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001053.1-363s1c1
Sequence:CCGGCAACCAGTTCACCAGTGTCTTCTCGAGAAGACACTGGTGAACTGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001053.1-792s1c1
Sequence:CCGGCTTCACCGTCAACATCGTCAACTCGAGTTGACGATGTTGACGGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001053.1-849s1c1
Sequence:CCGGCGGCCTCTACTTCTTCGTGGTCTCGAGACCACGAAGAAGTAGAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001053.2-881s21c1
Sequence:CCGGTTCACCGTCAACATCGTCAACCTCGAGGTTGACGATGTTGACGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001053.2-306s21c1
Sequence:CCGGCCGTCACCAACATCTACATTCCTCGAGGAATGTAGATGTTGGTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001053.2-453s21c1
Sequence:CCGGACCAGTTCACCAGTGTCTTCTCTCGAGAGAAGACACTGGTGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001053.2-957s21c1
Sequence:CCGGTCATCCTCTCCTACGCCAACACTCGAGTGTTGGCGTAGGAGAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001053
SSTR5 MISSION shRNA Lentiviral Transduction Particles
somatostatin receptor 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001053.1-219s1c1
Sequence:CCGGCGTCACCAACATCTACATTCTCTCGAGAGAATGTAGATGTTGGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001053.1-363s1c1
Sequence:CCGGCAACCAGTTCACCAGTGTCTTCTCGAGAAGACACTGGTGAACTGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001053.1-792s1c1
Sequence:CCGGCTTCACCGTCAACATCGTCAACTCGAGTTGACGATGTTGACGGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001053.1-849s1c1
Sequence:CCGGCGGCCTCTACTTCTTCGTGGTCTCGAGACCACGAAGAAGTAGAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001053.2-881s21c1
Sequence:CCGGTTCACCGTCAACATCGTCAACCTCGAGGTTGACGATGTTGACGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001053.2-306s21c1
Sequence:CCGGCCGTCACCAACATCTACATTCCTCGAGGAATGTAGATGTTGGTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001053.2-453s21c1
Sequence:CCGGACCAGTTCACCAGTGTCTTCTCTCGAGAGAAGACACTGGTGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001053.2-957s21c1
Sequence:CCGGTCATCCTCTCCTACGCCAACACTCGAGTGTTGGCGTAGGAGAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_139909
SSTR5 MISSION shRNA Bacterial Glycerol Stock
somatostatin receptor 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139909.2-1101s1c1
Sequence:CCGGGCCTTTCTTCATCGTCAACATCTCGAGATGTTGACGATGAAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139909.2-978s1c1
Sequence:CCGGGCTCATCGTAGTGAAGGTGAACTCGAGTTCACCTTCACTACGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139909.2-1238s1c1
Sequence:CCGGCTGATAACTTCCGCCAGAGTTCTCGAGAACTCTGGCGGAAGTTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139909.2-525s1c1
Sequence:CCGGGACAGTTACTAACGTGTATATCTCGAGATATACACGTTAGTAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139909.2-439s1c1
Sequence:CCGGCCTGTGCTCTACTTGTTGGTACTCGAGTACCAACAAGTAGAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_139909
SSTR5 MISSION shRNA shRNA Plasmid DNA
somatostatin receptor 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139909.2-1101s1c1
Sequence:CCGGGCCTTTCTTCATCGTCAACATCTCGAGATGTTGACGATGAAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139909.2-978s1c1
Sequence:CCGGGCTCATCGTAGTGAAGGTGAACTCGAGTTCACCTTCACTACGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139909.2-1238s1c1
Sequence:CCGGCTGATAACTTCCGCCAGAGTTCTCGAGAACTCTGGCGGAAGTTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139909.2-525s1c1
Sequence:CCGGGACAGTTACTAACGTGTATATCTCGAGATATACACGTTAGTAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139909.2-439s1c1
Sequence:CCGGCCTGTGCTCTACTTGTTGGTACTCGAGTACCAACAAGTAGAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_139909
SSTR5 MISSION shRNA Lentiviral Transduction Particles
somatostatin receptor 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139909.2-1101s1c1
Sequence:CCGGGCCTTTCTTCATCGTCAACATCTCGAGATGTTGACGATGAAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139909.2-978s1c1
Sequence:CCGGGCTCATCGTAGTGAAGGTGAACTCGAGTTCACCTTCACTACGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139909.2-1238s1c1
Sequence:CCGGCTGATAACTTCCGCCAGAGTTCTCGAGAACTCTGGCGGAAGTTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139909.2-525s1c1
Sequence:CCGGGACAGTTACTAACGTGTATATCTCGAGATATACACGTTAGTAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139909.2-439s1c1
Sequence:CCGGCCTGTGCTCTACTTGTTGGTACTCGAGTACCAACAAGTAGAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks