EMAIL THIS PAGE TO A FRIEND

SSU72

SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)

Synonyms: HSPC182 PNAS-120
UniProtKB ID: Q9NP77, Q9BZS6, Q9H933
Gene ID:
Mouse(68991) Ssu72 RNA polymerase II CTD phosphatase homolog (yeast)
Rat(298681) SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)
cow(614837) SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)
sheep(101103254) SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)
domestic guinea pig(100727342) SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)
naked mole-rat(101708866) SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)
fruit fly(32973) Ssu72 ortholog
dog(479567) SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)
chicken(419410) SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)
Zebrafish(393701) SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014188 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014188 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014188 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026899 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026899 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026899 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125471 MISSION® esiRNA esiRNA human SSU72 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014188 Rosetta Predictions human pricing
NM_001025657 Rosetta Predictions rat pricing
NM_026899 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024012 predicted 935
2 SASI_Hs01_00024013 predicted 475
3 SASI_Hs01_00024014 predicted 623
4 SASI_Hs01_00024015 predicted 1055
5 SASI_Hs01_00024016 predicted 411
6 SASI_Hs01_00024017 predicted 999
7 SASI_Hs01_00024018 predicted 506
8 SASI_Hs01_00024019 predicted 1055
9 SASI_Hs01_00024020 predicted 618
10 SASI_Hs01_00024021 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025657 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043147 predicted 653
2 SASI_Rn01_00043148 predicted 410
3 SASI_Rn01_00043149 predicted 562
4 SASI_Rn01_00043150 predicted 414
5 SASI_Rn01_00043151 predicted 505
6 SASI_Rn01_00043152 predicted 434
7 SASI_Rn01_00043153 predicted 600
8 SASI_Rn01_00043154 predicted 338
9 SASI_Rn01_00043156 predicted 550
10 SASI_Rn02_00203238 predicted 289
11 SASI_Rn01_00043155 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026899 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102806 predicted 642
2 SASI_Mm01_00102807 predicted 1131
3 SASI_Mm02_00331171 predicted 719
4 SASI_Mm01_00102809 predicted 624
5 SASI_Mm01_00102808 predicted 737
6 SASI_Mm01_00102811 predicted 635
7 SASI_Mm02_00331172 predicted 716
8 SASI_Mm01_00102814 predicted 900
9 SASI_Mm01_00102812 predicted 737
10 SASI_Mm02_00331173 predicted 804
11 SASI_Mm01_00102805 predicted 655
12 SASI_Mm01_00102810 predicted 428
13 SASI_Mm01_00102813 predicted 415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014188
VALIDATED
SSU72 MISSION shRNA Bacterial Glycerol Stock
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014188.2-805s21c1
Sequence:CCGGGTGTATCCAGCACACGGAAGACTCGAGTCTTCCGTGTGCTGGATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014188.2-732s21c1
Sequence:CCGGTGGTCAATGTGGACATCCAGGCTCGAGCCTGGATGTCCACATTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014188.2-1006s21c1
Sequence:CCGGACGGTAGCATTACCCAAATAACTCGAGTTATTTGGGTAATGCTACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014188.2-414s21c1
Sequence:CCGGGATTCAGCGTCCGATCCTTTGCTCGAGCAAAGGATCGGACGCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014188.2-514s21c1
Sequence:CCGGGATGTACAATGATCTTCTTAGCTCGAGCTAAGAAGATCATTGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014188.2-619s1c1
Sequence:CCGGCCAGAACTGCAAAGACCTGTTCTCGAGAACAGGTCTTTGCAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014188.2-736s1c1
Sequence:CCGGCAATGTGGACATCCAGGACAACTCGAGTTGTCCTGGATGTCCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014188.2-641s1c1
Sequence:CCGGGATCTGATCCTCACTTGCGAACTCGAGTTCGCAAGTGAGGATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014188.2-1063s1c1
Sequence:CCGGGCCAGATGAAAGCAATCAAGTCTCGAGACTTGATTGCTTTCATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014188.2-611s1c1
Sequence:CCGGGAAAGATTCCAGAACTGCAAACTCGAGTTTGCAGTTCTGGAATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014188.2-1064s1c1
Sequence:CCGGCCAGATGAAAGCAATCAAGTTCTCGAGAACTTGATTGCTTTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014188.2-620s1c1
Sequence:CCGGCAGAACTGCAAAGACCTGTTTCTCGAGAAACAGGTCTTTGCAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014188.2-628s1c1
Sequence:CCGGCAAAGACCTGTTTGATCTGATCTCGAGATCAGATCAAACAGGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014188
VALIDATED
SSU72 MISSION shRNA shRNA Plasmid DNA
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014188.2-805s21c1
Sequence:CCGGGTGTATCCAGCACACGGAAGACTCGAGTCTTCCGTGTGCTGGATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014188.2-732s21c1
Sequence:CCGGTGGTCAATGTGGACATCCAGGCTCGAGCCTGGATGTCCACATTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014188.2-1006s21c1
Sequence:CCGGACGGTAGCATTACCCAAATAACTCGAGTTATTTGGGTAATGCTACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014188.2-414s21c1
Sequence:CCGGGATTCAGCGTCCGATCCTTTGCTCGAGCAAAGGATCGGACGCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014188.2-514s21c1
Sequence:CCGGGATGTACAATGATCTTCTTAGCTCGAGCTAAGAAGATCATTGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014188.2-619s1c1
Sequence:CCGGCCAGAACTGCAAAGACCTGTTCTCGAGAACAGGTCTTTGCAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014188.2-736s1c1
Sequence:CCGGCAATGTGGACATCCAGGACAACTCGAGTTGTCCTGGATGTCCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014188.2-641s1c1
Sequence:CCGGGATCTGATCCTCACTTGCGAACTCGAGTTCGCAAGTGAGGATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014188.2-1063s1c1
Sequence:CCGGGCCAGATGAAAGCAATCAAGTCTCGAGACTTGATTGCTTTCATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014188.2-611s1c1
Sequence:CCGGGAAAGATTCCAGAACTGCAAACTCGAGTTTGCAGTTCTGGAATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014188.2-1064s1c1
Sequence:CCGGCCAGATGAAAGCAATCAAGTTCTCGAGAACTTGATTGCTTTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014188.2-620s1c1
Sequence:CCGGCAGAACTGCAAAGACCTGTTTCTCGAGAAACAGGTCTTTGCAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014188.2-628s1c1
Sequence:CCGGCAAAGACCTGTTTGATCTGATCTCGAGATCAGATCAAACAGGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014188
VALIDATED
SSU72 MISSION shRNA Lentiviral Transduction Particles
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014188.2-805s21c1
Sequence:CCGGGTGTATCCAGCACACGGAAGACTCGAGTCTTCCGTGTGCTGGATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014188.2-732s21c1
Sequence:CCGGTGGTCAATGTGGACATCCAGGCTCGAGCCTGGATGTCCACATTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014188.2-1006s21c1
Sequence:CCGGACGGTAGCATTACCCAAATAACTCGAGTTATTTGGGTAATGCTACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014188.2-414s21c1
Sequence:CCGGGATTCAGCGTCCGATCCTTTGCTCGAGCAAAGGATCGGACGCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014188.2-514s21c1
Sequence:CCGGGATGTACAATGATCTTCTTAGCTCGAGCTAAGAAGATCATTGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014188.2-619s1c1
Sequence:CCGGCCAGAACTGCAAAGACCTGTTCTCGAGAACAGGTCTTTGCAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014188.2-736s1c1
Sequence:CCGGCAATGTGGACATCCAGGACAACTCGAGTTGTCCTGGATGTCCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014188.2-641s1c1
Sequence:CCGGGATCTGATCCTCACTTGCGAACTCGAGTTCGCAAGTGAGGATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014188.2-1063s1c1
Sequence:CCGGGCCAGATGAAAGCAATCAAGTCTCGAGACTTGATTGCTTTCATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014188.2-611s1c1
Sequence:CCGGGAAAGATTCCAGAACTGCAAACTCGAGTTTGCAGTTCTGGAATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014188.2-1064s1c1
Sequence:CCGGCCAGATGAAAGCAATCAAGTTCTCGAGAACTTGATTGCTTTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014188.2-620s1c1
Sequence:CCGGCAGAACTGCAAAGACCTGTTTCTCGAGAAACAGGTCTTTGCAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014188.2-628s1c1
Sequence:CCGGCAAAGACCTGTTTGATCTGATCTCGAGATCAGATCAAACAGGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026899
VALIDATED
SSU72 MISSION shRNA Bacterial Glycerol Stock
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026899.3-904s21c1
Sequence:CCGGGAGAGAGTCTATGACCAGGTTCTCGAGAACCTGGTCATAGACTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026899.3-720s21c1
Sequence:CCGGGCCCAATGTTTATGACTTCAACTCGAGTTGAAGTCATAAACATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026899.3-781s21c1
Sequence:CCGGGACAAAGAACTCTATACACAACTCGAGTTGTGTATAGAGTTCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026899.3-1189s21c1
Sequence:CCGGCCACCTTTGTTGAAGCCACTTCTCGAGAAGTGGCTTCAACAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111980    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026899.1-880s1c1
Sequence:CCGGCCACCTTTGTTGAAGCCACTTCTCGAGAAGTGGCTTCAACAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026899.1-411s1c1
Sequence:CCGGGCCCAATGTTTATGACTTCAACTCGAGTTGAAGTCATAAACATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026899.1-472s1c1
Sequence:CCGGGACAAAGAACTCTATACACAACTCGAGTTGTGTATAGAGTTCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026899.1-595s1c1
Sequence:CCGGGAGAGAGTCTATGACCAGGTTCTCGAGAACCTGGTCATAGACTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026899
VALIDATED
SSU72 MISSION shRNA shRNA Plasmid DNA
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026899.3-904s21c1
Sequence:CCGGGAGAGAGTCTATGACCAGGTTCTCGAGAACCTGGTCATAGACTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026899.3-720s21c1
Sequence:CCGGGCCCAATGTTTATGACTTCAACTCGAGTTGAAGTCATAAACATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026899.3-781s21c1
Sequence:CCGGGACAAAGAACTCTATACACAACTCGAGTTGTGTATAGAGTTCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026899.3-1189s21c1
Sequence:CCGGCCACCTTTGTTGAAGCCACTTCTCGAGAAGTGGCTTCAACAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111980    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026899.1-880s1c1
Sequence:CCGGCCACCTTTGTTGAAGCCACTTCTCGAGAAGTGGCTTCAACAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026899.1-411s1c1
Sequence:CCGGGCCCAATGTTTATGACTTCAACTCGAGTTGAAGTCATAAACATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026899.1-472s1c1
Sequence:CCGGGACAAAGAACTCTATACACAACTCGAGTTGTGTATAGAGTTCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026899.1-595s1c1
Sequence:CCGGGAGAGAGTCTATGACCAGGTTCTCGAGAACCTGGTCATAGACTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026899
VALIDATED
SSU72 MISSION shRNA Lentiviral Transduction Particles
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026899.3-904s21c1
Sequence:CCGGGAGAGAGTCTATGACCAGGTTCTCGAGAACCTGGTCATAGACTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026899.3-720s21c1
Sequence:CCGGGCCCAATGTTTATGACTTCAACTCGAGTTGAAGTCATAAACATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026899.3-781s21c1
Sequence:CCGGGACAAAGAACTCTATACACAACTCGAGTTGTGTATAGAGTTCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026899.3-1189s21c1
Sequence:CCGGCCACCTTTGTTGAAGCCACTTCTCGAGAAGTGGCTTCAACAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111980    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026899.1-880s1c1
Sequence:CCGGCCACCTTTGTTGAAGCCACTTCTCGAGAAGTGGCTTCAACAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026899.1-411s1c1
Sequence:CCGGGCCCAATGTTTATGACTTCAACTCGAGTTGAAGTCATAAACATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026899.1-472s1c1
Sequence:CCGGGACAAAGAACTCTATACACAACTCGAGTTGTGTATAGAGTTCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026899.1-595s1c1
Sequence:CCGGGAGAGAGTCTATGACCAGGTTCTCGAGAACCTGGTCATAGACTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks