EMAIL THIS PAGE TO A FRIEND

SSU72P1

SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 1

Species: Human SSU72P1(286528)
Gene ID:
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_210501 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_210501 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_210501 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714710 Rosetta Predictions human pricing
XM_210501 Rosetta Predictions human pricing
XM_937399 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00398895 predicted 299
2 SASI_Hs02_00398896 predicted 206
3 SASI_Hs02_00398897 predicted 292
4 SASI_Hs02_00398898 predicted 322
5 SASI_Hs02_00398899 predicted 223
6 SASI_Hs02_00398900 predicted 304
7 SASI_Hs02_00398901 predicted 231
8 SASI_Hs02_00398902 predicted 204
9 SASI_Hs02_00398903 predicted 286
10 SASI_Hs02_00398904 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_210501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478982 predicted 300
2 SASI_Hs02_00478983 predicted 214
3 SASI_Hs02_00478984 predicted 288
4 SASI_Hs02_00478985 predicted 325
5 SASI_Hs02_00478986 predicted 222
6 SASI_Hs02_00478987 predicted 303
7 SASI_Hs02_00478988 predicted 235
8 SASI_Hs02_00478989 predicted 201
9 SASI_Hs02_00478990 predicted 283
10 SASI_Hs02_00478991 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_937399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482606 predicted 298
2 SASI_Hs02_00482607 predicted 215
3 SASI_Hs02_00482608 predicted 287
4 SASI_Hs02_00482609 predicted 323
5 SASI_Hs02_00482610 predicted 225
6 SASI_Hs02_00482611 predicted 301
7 SASI_Hs02_00482612 predicted 235
8 SASI_Hs02_00482613 predicted 200
9 SASI_Hs02_00482614 predicted 288
10 SASI_Hs02_00482615 predicted 236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_210501
SSU72P1 MISSION shRNA Bacterial Glycerol Stock
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 1
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000204110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210501.3-286s1c1
Sequence:CCGGGAAAGGTTCCAGGATTGCAAACTCGAGTTTGCAATCCTGGAACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210501.3-324s1c1
Sequence:CCGGCATCACTTGTGAAGAGAGCATCTCGAGATGCTCTCTTCACAAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_210501
SSU72P1 MISSION shRNA shRNA Plasmid DNA
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 1
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000204110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210501.3-286s1c1
Sequence:CCGGGAAAGGTTCCAGGATTGCAAACTCGAGTTTGCAATCCTGGAACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210501.3-324s1c1
Sequence:CCGGCATCACTTGTGAAGAGAGCATCTCGAGATGCTCTCTTCACAAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_210501
SSU72P1 MISSION shRNA Lentiviral Transduction Particles
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 1
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000204110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210501.3-286s1c1
Sequence:CCGGGAAAGGTTCCAGGATTGCAAACTCGAGTTTGCAATCCTGGAACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210501.3-324s1c1
Sequence:CCGGCATCACTTGTGAAGAGAGCATCTCGAGATGCTCTCTTCACAAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks