EMAIL THIS PAGE TO A FRIEND

SSU72P2

SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 2

Species: Human SSU72P2(390031)
Gene ID:
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372343 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372343 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372343 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718915 Rosetta Predictions human pricing
XM_372343 Rosetta Predictions human pricing
XM_939626 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00427120 predicted 267
2 SASI_Hs02_00427121 predicted 222
3 SASI_Hs02_00427122 predicted 289
4 SASI_Hs02_00427123 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479404 predicted 260
2 SASI_Hs02_00479405 predicted 216
3 SASI_Hs02_00479406 predicted 290
4 SASI_Hs02_00479407 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_939626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483751 predicted 265
2 SASI_Hs02_00483752 predicted 299
3 SASI_Hs02_00483753 predicted 222
4 SASI_Hs02_00483754 predicted 216
5 SASI_Hs02_00483755 predicted 294
6 SASI_Hs02_00483756 predicted 291
7 SASI_Hs02_00483757 predicted 303
8 SASI_Hs02_00483758 predicted 486
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372343
SSU72P2 MISSION shRNA Bacterial Glycerol Stock
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372343.1-414s1c1
Sequence:CCGGCATGGAAATCCAAGATACCCTCTCGAGAGGGTATCTTGGATTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372343.1-334s1c1
Sequence:CCGGGAGGAGAGTGTCTATGACACACTCGAGTGTGTCATAGACACTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372343.1-400s1c1
Sequence:CCGGGTGCACGTGATCAACATGGAACTCGAGTTCCATGTTGATCACGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372343.1-145s1c1
Sequence:CCGGCCCAATCGTCCTGTAGTTTATCTCGAGATAAACTACAGGACGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372343.1-298s1c1
Sequence:CCGGGAGTGCACTGATTTCTTTGATCTCGAGATCAAAGAAATCAGTGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372343.1-303s1c1
Sequence:CCGGCACTGATTTCTTTGATGTCATCTCGAGATGACATCAAAGAAATCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372343.1-284s1c1
Sequence:CCGGCAGAAAGATTTCAGGAGTGCACTCGAGTGCACTCCTGAAATCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372343
SSU72P2 MISSION shRNA shRNA Plasmid DNA
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372343.1-414s1c1
Sequence:CCGGCATGGAAATCCAAGATACCCTCTCGAGAGGGTATCTTGGATTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372343.1-334s1c1
Sequence:CCGGGAGGAGAGTGTCTATGACACACTCGAGTGTGTCATAGACACTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372343.1-400s1c1
Sequence:CCGGGTGCACGTGATCAACATGGAACTCGAGTTCCATGTTGATCACGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372343.1-145s1c1
Sequence:CCGGCCCAATCGTCCTGTAGTTTATCTCGAGATAAACTACAGGACGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372343.1-298s1c1
Sequence:CCGGGAGTGCACTGATTTCTTTGATCTCGAGATCAAAGAAATCAGTGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372343.1-303s1c1
Sequence:CCGGCACTGATTTCTTTGATGTCATCTCGAGATGACATCAAAGAAATCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372343.1-284s1c1
Sequence:CCGGCAGAAAGATTTCAGGAGTGCACTCGAGTGCACTCCTGAAATCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372343
SSU72P2 MISSION shRNA Lentiviral Transduction Particles
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372343.1-414s1c1
Sequence:CCGGCATGGAAATCCAAGATACCCTCTCGAGAGGGTATCTTGGATTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372343.1-334s1c1
Sequence:CCGGGAGGAGAGTGTCTATGACACACTCGAGTGTGTCATAGACACTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372343.1-400s1c1
Sequence:CCGGGTGCACGTGATCAACATGGAACTCGAGTTCCATGTTGATCACGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372343.1-145s1c1
Sequence:CCGGCCCAATCGTCCTGTAGTTTATCTCGAGATAAACTACAGGACGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372343.1-298s1c1
Sequence:CCGGGAGTGCACTGATTTCTTTGATCTCGAGATCAAAGAAATCAGTGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372343.1-303s1c1
Sequence:CCGGCACTGATTTCTTTGATGTCATCTCGAGATGACATCAAAGAAATCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372343.1-284s1c1
Sequence:CCGGCAGAAAGATTTCAGGAGTGCACTCGAGTGCACTCCTGAAATCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks