EMAIL THIS PAGE TO A FRIEND

SSU72P3

SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 3

Species: Human SSU72P3(143506)
Gene ID:
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_089866 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_089866 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_089866 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001720025 Rosetta Predictions human pricing
XM_089866 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00434081 predicted 261
2 SASI_Hs02_00434082 predicted 294
3 SASI_Hs02_00434083 predicted 218
4 SASI_Hs02_00434084 predicted 220
5 SASI_Hs02_00434085 predicted 296
6 SASI_Hs02_00434086 predicted 297
7 SASI_Hs02_00434087 predicted 299
8 SASI_Hs02_00434088 predicted 485
9 SASI_Hs02_00434089 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_089866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478830 predicted 262
2 SASI_Hs02_00478831 predicted 297
3 SASI_Hs02_00478832 predicted 217
4 SASI_Hs02_00478833 predicted 219
5 SASI_Hs02_00478834 predicted 295
6 SASI_Hs02_00478835 predicted 297
7 SASI_Hs02_00478836 predicted 302
8 SASI_Hs02_00478837 predicted 487
9 SASI_Hs02_00478838 predicted 487
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_089866
SSU72P3 MISSION shRNA Bacterial Glycerol Stock
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000197316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_089866.3-143s1c2
Sequence:CCGGGACCCAATCGTCCTGTAGTTTCTCGAGAAACTACAGGACGATTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_089866.3-207s1c1
Sequence:CCGGCAGGAAAGATAGAGAACGCTACTCGAGTAGCGTTCTCTATCTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_089866.3-39s1c1
Sequence:CCGGGAGCAATGTCAACAGGAGCATCTCGAGATGCTCCTGTTGACATTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_089866.3-418s1c1
Sequence:CCGGGACATCCAAGATACCCTGGAACTCGAGTTCCAGGGTATCTTGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_089866
SSU72P3 MISSION shRNA shRNA Plasmid DNA
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000197316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_089866.3-143s1c2
Sequence:CCGGGACCCAATCGTCCTGTAGTTTCTCGAGAAACTACAGGACGATTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_089866.3-207s1c1
Sequence:CCGGCAGGAAAGATAGAGAACGCTACTCGAGTAGCGTTCTCTATCTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_089866.3-39s1c1
Sequence:CCGGGAGCAATGTCAACAGGAGCATCTCGAGATGCTCCTGTTGACATTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_089866.3-418s1c1
Sequence:CCGGGACATCCAAGATACCCTGGAACTCGAGTTCCAGGGTATCTTGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_089866
SSU72P3 MISSION shRNA Lentiviral Transduction Particles
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000197316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_089866.3-143s1c2
Sequence:CCGGGACCCAATCGTCCTGTAGTTTCTCGAGAAACTACAGGACGATTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_089866.3-207s1c1
Sequence:CCGGCAGGAAAGATAGAGAACGCTACTCGAGTAGCGTTCTCTATCTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_089866.3-39s1c1
Sequence:CCGGGAGCAATGTCAACAGGAGCATCTCGAGATGCTCCTGTTGACATTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_089866.3-418s1c1
Sequence:CCGGGACATCCAAGATACCCTGGAACTCGAGTTCCAGGGTATCTTGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks