EMAIL THIS PAGE TO A FRIEND

SSU72P4

SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 4

Species: Human SSU72P4(441584)
Gene ID:
5 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_497258 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_497258 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_497258 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_497258 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_497258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480081 predicted 264
2 SASI_Hs02_00480082 predicted 221
3 SASI_Hs02_00480083 predicted 220
4 SASI_Hs02_00480084 predicted 294
5 SASI_Hs02_00480085 predicted 492
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_497258
SSU72P4 MISSION shRNA Bacterial Glycerol Stock
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 4
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000202896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497258.1-173s1c1
Sequence:CCGGCAACAACATATAAGGAGATGTCTCGAGACATCTCCTTATATGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497258.1-305s1c1
Sequence:CCGGCTGATTTCTTTGATGTCATCTCTCGAGAGATGACATCAAAGAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_497258
SSU72P4 MISSION shRNA shRNA Plasmid DNA
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 4
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000202896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497258.1-173s1c1
Sequence:CCGGCAACAACATATAAGGAGATGTCTCGAGACATCTCCTTATATGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497258.1-305s1c1
Sequence:CCGGCTGATTTCTTTGATGTCATCTCTCGAGAGATGACATCAAAGAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_497258
SSU72P4 MISSION shRNA Lentiviral Transduction Particles
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 4
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000202896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497258.1-173s1c1
Sequence:CCGGCAACAACATATAAGGAGATGTCTCGAGACATCTCCTTATATGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497258.1-305s1c1
Sequence:CCGGCTGATTTCTTTGATGTCATCTCTCGAGAGATGACATCAAAGAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks