EMAIL THIS PAGE TO A FRIEND

SSU72P5

SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 5

Species: Human SSU72P5(196120)
Gene ID:
15 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_114987 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_114987 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_114987 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718918 Rosetta Predictions human pricing
XM_114987 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00427141 predicted 266
2 SASI_Hs02_00427142 predicted 297
3 SASI_Hs02_00427143 predicted 301
4 SASI_Hs02_00427144 predicted 222
5 SASI_Hs02_00427145 predicted 288
6 SASI_Hs02_00427146 predicted 295
7 SASI_Hs02_00427147 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_114987 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478868 predicted 260
2 SASI_Hs02_00478869 predicted 294
3 SASI_Hs02_00478870 predicted 221
4 SASI_Hs02_00478871 predicted 218
5 SASI_Hs02_00478872 predicted 292
6 SASI_Hs02_00478873 predicted 291
7 SASI_Hs02_00478874 predicted 302
8 SASI_Hs02_00478875 predicted 491
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_114987
SSU72P5 MISSION shRNA Bacterial Glycerol Stock
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_114987.3-311s1c1
Sequence:CCGGCCTTTGATGTCATCTTCACCTCTCGAGAGGTGAAGATGACATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_114987.3-361s1c1
Sequence:CCGGGAAGATCTGTGTTCCAGAGAACTCGAGTTCTCTGGAACACAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_114987.3-418s1c1
Sequence:CCGGGAAATCCAAGATACCCTGGAACTCGAGTTCCAGGGTATCTTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_114987.3-298s1c1
Sequence:CCGGGAGTGCACTGATTCCTTTGATCTCGAGATCAAAGGAATCAGTGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_114987.3-402s1c1
Sequence:CCGGGCACGTGATCAACATGGAAATCTCGAGATTTCCATGTTGATCACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_114987
SSU72P5 MISSION shRNA shRNA Plasmid DNA
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_114987.3-311s1c1
Sequence:CCGGCCTTTGATGTCATCTTCACCTCTCGAGAGGTGAAGATGACATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_114987.3-361s1c1
Sequence:CCGGGAAGATCTGTGTTCCAGAGAACTCGAGTTCTCTGGAACACAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_114987.3-418s1c1
Sequence:CCGGGAAATCCAAGATACCCTGGAACTCGAGTTCCAGGGTATCTTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_114987.3-298s1c1
Sequence:CCGGGAGTGCACTGATTCCTTTGATCTCGAGATCAAAGGAATCAGTGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_114987.3-402s1c1
Sequence:CCGGGCACGTGATCAACATGGAAATCTCGAGATTTCCATGTTGATCACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_114987
SSU72P5 MISSION shRNA Lentiviral Transduction Particles
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_114987.3-311s1c1
Sequence:CCGGCCTTTGATGTCATCTTCACCTCTCGAGAGGTGAAGATGACATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_114987.3-361s1c1
Sequence:CCGGGAAGATCTGTGTTCCAGAGAACTCGAGTTCTCTGGAACACAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_114987.3-418s1c1
Sequence:CCGGGAAATCCAAGATACCCTGGAACTCGAGTTCCAGGGTATCTTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_114987.3-298s1c1
Sequence:CCGGGAGTGCACTGATTCCTTTGATCTCGAGATCAAAGGAATCAGTGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_114987.3-402s1c1
Sequence:CCGGGCACGTGATCAACATGGAAATCTCGAGATTTCCATGTTGATCACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks