EMAIL THIS PAGE TO A FRIEND

SSU72P8

SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 8

Species: Human SSU72P8(136157)
Gene ID:
10 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_069743 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_069743 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_069743 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085395 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317575 predicted 261
2 SASI_Hs02_00317576 predicted 222
3 SASI_Hs02_00317577 predicted 228
4 SASI_Hs02_00317578 predicted 291
5 SASI_Hs02_00317579 predicted 215
6 SASI_Hs02_00317580 predicted 260
7 SASI_Hs02_00317581 predicted 223
8 SASI_Hs02_00317582 predicted 272
9 SASI_Hs02_00317583 predicted 282
10 SASI_Hs02_00317584 predicted 326
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_069743
SSU72P8 MISSION shRNA Bacterial Glycerol Stock
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-418s1c1
Sequence:CCGGGACATCAAAGATACCCTGGAACTCGAGTTCCAGGGTATCTTTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-230s1c1
Sequence:CCGGCCCACAATGGAATCTTACACACTCGAGTGTGTAAGATTCCATTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-252s1c1
Sequence:CCGGCTTGGGAAGAAATGAGAGAATCTCGAGATTCTCTCATTTCTTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-231s1c1
Sequence:CCGGCCACAATGGAATCTTACACATCTCGAGATGTGTAAGATTCCATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-207s1c1
Sequence:CCGGCAGGAAAGATAGAGAATGCTACTCGAGTAGCATTCTCTATCTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-290s1c1
Sequence:CCGGGATTTCAGGAATGCACTGAATCTCGAGATTCAGTGCATTCCTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-402s1c1
Sequence:CCGGGCACGTGATCAACATGGACATCTCGAGATGTCCATGTTGATCACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-39s1c1
Sequence:CCGGGAGCAACATCAACAGGAGCATCTCGAGATGCTCCTGTTGATGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_069743
SSU72P8 MISSION shRNA shRNA Plasmid DNA
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-418s1c1
Sequence:CCGGGACATCAAAGATACCCTGGAACTCGAGTTCCAGGGTATCTTTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-230s1c1
Sequence:CCGGCCCACAATGGAATCTTACACACTCGAGTGTGTAAGATTCCATTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-252s1c1
Sequence:CCGGCTTGGGAAGAAATGAGAGAATCTCGAGATTCTCTCATTTCTTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-231s1c1
Sequence:CCGGCCACAATGGAATCTTACACATCTCGAGATGTGTAAGATTCCATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-207s1c1
Sequence:CCGGCAGGAAAGATAGAGAATGCTACTCGAGTAGCATTCTCTATCTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-290s1c1
Sequence:CCGGGATTTCAGGAATGCACTGAATCTCGAGATTCAGTGCATTCCTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-402s1c1
Sequence:CCGGGCACGTGATCAACATGGACATCTCGAGATGTCCATGTTGATCACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-39s1c1
Sequence:CCGGGAGCAACATCAACAGGAGCATCTCGAGATGCTCCTGTTGATGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_069743
SSU72P8 MISSION shRNA Lentiviral Transduction Particles
SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) pseudogene 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-418s1c1
Sequence:CCGGGACATCAAAGATACCCTGGAACTCGAGTTCCAGGGTATCTTTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-230s1c1
Sequence:CCGGCCCACAATGGAATCTTACACACTCGAGTGTGTAAGATTCCATTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-252s1c1
Sequence:CCGGCTTGGGAAGAAATGAGAGAATCTCGAGATTCTCTCATTTCTTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-231s1c1
Sequence:CCGGCCACAATGGAATCTTACACATCTCGAGATGTGTAAGATTCCATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-207s1c1
Sequence:CCGGCAGGAAAGATAGAGAATGCTACTCGAGTAGCATTCTCTATCTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-290s1c1
Sequence:CCGGGATTTCAGGAATGCACTGAATCTCGAGATTCAGTGCATTCCTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-402s1c1
Sequence:CCGGGCACGTGATCAACATGGACATCTCGAGATGTCCATGTTGATCACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069743.3-39s1c1
Sequence:CCGGGAGCAACATCAACAGGAGCATCTCGAGATGCTCCTGTTGATGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks