EMAIL THIS PAGE TO A FRIEND

SSUH2

ssu-2 homolog (C. elegans)

Synonyms: C3orf32 SSU-2 fls485
UniProtKB ID: Q9Y2M2, A6NFA9, B3KS84, B7Z6E3, F5H2S5, Q7Z7K4
Gene ID:
Rat(500286) ssu-2 homolog
dog(484672) ssu-2 homolog (C. elegans)
naked mole-rat(101716175) ssu-2 homolog (C. elegans)
domestic guinea pig(100732537) ssu-2 homolog (C. elegans)
sheep(101107477) ssu-2 homolog (C. elegans)
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015931 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015931 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015931 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070281 MISSION® esiRNA esiRNA human C3orf32 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015931 Rosetta Predictions human pricing
XM_001078533 Rosetta Predictions rat pricing
XM_575636 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206475 predicted 662
2 SASI_Hs01_00206476 predicted 550
3 SASI_Hs01_00206477 predicted 640
4 SASI_Hs01_00206478 predicted 1184
5 SASI_Hs01_00206479 predicted 1251
6 SASI_Hs02_00348555 predicted 287
7 SASI_Hs01_00206480 predicted 1262
8 SASI_Hs01_00206481 predicted 1240
9 SASI_Hs01_00206483 predicted 686
10 SASI_Hs02_00348556 predicted 257
11 SASI_Hs01_00206474 predicted 1219
12 SASI_Hs01_00206482 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078533 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361159 predicted 367
2 SASI_Rn02_00361160 predicted 312
3 SASI_Rn02_00361161 predicted 215
4 SASI_Rn02_00361162 predicted 359
5 SASI_Rn02_00361163 predicted 356
6 SASI_Rn02_00361164 predicted 330
7 SASI_Rn02_00361165 predicted 446
8 SASI_Rn02_00361166 predicted 268
9 SASI_Rn02_00361167 predicted 494
10 SASI_Rn02_00361168 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575636 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00178607 predicted 247
2 SASI_Rn01_00178608 predicted 231
3 SASI_Rn01_00178609 predicted 604
4 SASI_Rn01_00178610 predicted 509
5 SASI_Rn01_00178611 predicted 650
6 SASI_Rn01_00178612 predicted 448
7 SASI_Rn01_00178613 predicted 308
8 SASI_Rn01_00178614 predicted 369
9 SASI_Rn01_00178615 predicted 920
10 SASI_Rn01_00178616 predicted 481
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015931
SSUH2 MISSION shRNA Bacterial Glycerol Stock
ssu-2 homolog (C. elegans)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015931.1-1192s1c1
Sequence:CCGGGAAGTTCACTATTGGTACCAACTCGAGTTGGTACCAATAGTGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015931.1-1188s1c1
Sequence:CCGGCACAGAAGTTCACTATTGGTACTCGAGTACCAATAGTGAACTTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015931.1-1393s1c1
Sequence:CCGGGCATTGGACAATCACATACAACTCGAGTTGTATGTGATTGTCCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015931.1-1209s1c1
Sequence:CCGGCCAAGGAAAGACTTATGTCTACTCGAGTAGACATAAGTCTTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015931.1-1006s1c1
Sequence:CCGGCTTGCTAAAGCCAAAGGAGAACTCGAGTTCTCCTTTGGCTTTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015931.1-622s1c1
Sequence:CCGGCTCTGGGACATCAAGGTTCAACTCGAGTTGAACCTTGATGTCCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015931.1-909s1c1
Sequence:CCGGGAAGAAGCTGTTGCACTTCATCTCGAGATGAAGTGCAACAGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142308    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015931.1-1377s1c1
Sequence:CCGGGTGTTCACTGTTGGCTGCATTCTCGAGAATGCAGCCAACAGTGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015931.1-921s1c1
Sequence:CCGGGCACTTCATCCAGCTTGTCATCTCGAGATGACAAGCTGGATGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015931.1-429s1c1
Sequence:CCGGCCTCAGCTTTGTGGACTCTAACTCGAGTTAGAGTCCACAAAGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015931
SSUH2 MISSION shRNA shRNA Plasmid DNA
ssu-2 homolog (C. elegans)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015931.1-1192s1c1
Sequence:CCGGGAAGTTCACTATTGGTACCAACTCGAGTTGGTACCAATAGTGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015931.1-1188s1c1
Sequence:CCGGCACAGAAGTTCACTATTGGTACTCGAGTACCAATAGTGAACTTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015931.1-1393s1c1
Sequence:CCGGGCATTGGACAATCACATACAACTCGAGTTGTATGTGATTGTCCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015931.1-1209s1c1
Sequence:CCGGCCAAGGAAAGACTTATGTCTACTCGAGTAGACATAAGTCTTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015931.1-1006s1c1
Sequence:CCGGCTTGCTAAAGCCAAAGGAGAACTCGAGTTCTCCTTTGGCTTTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015931.1-622s1c1
Sequence:CCGGCTCTGGGACATCAAGGTTCAACTCGAGTTGAACCTTGATGTCCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015931.1-909s1c1
Sequence:CCGGGAAGAAGCTGTTGCACTTCATCTCGAGATGAAGTGCAACAGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142308    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015931.1-1377s1c1
Sequence:CCGGGTGTTCACTGTTGGCTGCATTCTCGAGAATGCAGCCAACAGTGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015931.1-921s1c1
Sequence:CCGGGCACTTCATCCAGCTTGTCATCTCGAGATGACAAGCTGGATGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015931.1-429s1c1
Sequence:CCGGCCTCAGCTTTGTGGACTCTAACTCGAGTTAGAGTCCACAAAGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015931
SSUH2 MISSION shRNA Lentiviral Transduction Particles
ssu-2 homolog (C. elegans)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015931.1-1192s1c1
Sequence:CCGGGAAGTTCACTATTGGTACCAACTCGAGTTGGTACCAATAGTGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015931.1-1188s1c1
Sequence:CCGGCACAGAAGTTCACTATTGGTACTCGAGTACCAATAGTGAACTTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015931.1-1393s1c1
Sequence:CCGGGCATTGGACAATCACATACAACTCGAGTTGTATGTGATTGTCCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015931.1-1209s1c1
Sequence:CCGGCCAAGGAAAGACTTATGTCTACTCGAGTAGACATAAGTCTTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015931.1-1006s1c1
Sequence:CCGGCTTGCTAAAGCCAAAGGAGAACTCGAGTTCTCCTTTGGCTTTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015931.1-622s1c1
Sequence:CCGGCTCTGGGACATCAAGGTTCAACTCGAGTTGAACCTTGATGTCCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015931.1-909s1c1
Sequence:CCGGGAAGAAGCTGTTGCACTTCATCTCGAGATGAAGTGCAACAGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142308    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015931.1-1377s1c1
Sequence:CCGGGTGTTCACTGTTGGCTGCATTCTCGAGAATGCAGCCAACAGTGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015931.1-921s1c1
Sequence:CCGGGCACTTCATCCAGCTTGTCATCTCGAGATGACAAGCTGGATGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015931.1-429s1c1
Sequence:CCGGCCTCAGCTTTGTGGACTCTAACTCGAGTTAGAGTCCACAAAGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks