EMAIL THIS PAGE TO A FRIEND

SSX1

synovial sarcoma, X breakpoint 1

Synonyms: CT5.1 SSRC
UniProtKB ID: Q16384, A3KN76, Q08AJ2, Q5JQ64
Gene ID:
Human(6756) Summary: The product of this gene belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. They are also capable of eliciting spontaneous humoral and cellular immune responses in cancer patients, and are potentially useful targets in cancer vaccine-based immunotherapy. This gene, and also the SSX2 and SSX4 family members, have been involved in t(X;18)(p11.2;q11.2) translocations that are characteristically found in all synovial sarcomas. This translocation results in the fusion of the synovial sarcoma translocation gene on chromosome 18 to one of the SSX genes on chromosome X. The encoded hybrid proteins are likely responsible for transforming activity. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome X. [provided by RefSeq, Jul 2013]
Rat(691903) synovial sarcoma, X breakpoint 1
domestic cat(101083323) synovial sarcoma, X breakpoint 1
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005635 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005635 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005635 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110361 MISSION® esiRNA esiRNA human SSX1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005635 Rosetta Predictions human pricing
XM_001080044 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339972 predicted 245
2 SASI_Hs01_00129996 predicted 783
3 SASI_Hs02_00339973 predicted 354
4 SASI_Hs01_00129997 predicted 154
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080044 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366359 predicted 408
2 SASI_Rn02_00366360 predicted 245
3 SASI_Rn02_00366361 predicted 407
4 SASI_Rn02_00366362 predicted 228
5 SASI_Rn02_00366363 predicted 429
6 SASI_Rn02_00366364 predicted 272
7 SASI_Rn02_00366365 predicted 239
8 SASI_Rn02_00366366 predicted 395
9 SASI_Rn02_00366367 predicted 390
10 SASI_Rn02_00366368 predicted 304
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005635
SSX1 MISSION shRNA Bacterial Glycerol Stock
synovial sarcoma, X breakpoint 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005635.2-403s1c1
Sequence:CCGGCCACAGAATCATCCCGAAGATCTCGAGATCTTCGGGATGATTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005635.2-123s1c1
Sequence:CCGGCCAGGGATGATGCTAAAGCATCTCGAGATGCTTTAGCATCATCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005635.2-292s1c1
Sequence:CCGGCCCACCTTTCATGTGTAATAACTCGAGTTATTACACATGAAAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005635.2-359s1c1
Sequence:CCGGCGCAGGATTCAGGTTGAACATCTCGAGATGTTCAACCTGAATCCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005635.2-176s1c1
Sequence:CCGGGCCACATACTTCTCTAAGAAACTCGAGTTTCTTAGAGAAGTATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005635.2-280s21c1
Sequence:CCGGCAAAGTCACCCTCCCACCTTTCTCGAGAAAGGTGGGAGGGTGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005635.2-906s21c1
Sequence:CCGGACTGAATGCATATTTCGGTTTCTCGAGAAACCGAAATATGCATTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005635.2-882s21c1
Sequence:CCGGCCTTATAATTGATGAGCAAGACTCGAGTCTTGCTCATCAATTATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005635.2-783s21c1
Sequence:CCGGACGGTGAAACTTGAGCGTCATCTCGAGATGACGCTCAAGTTTCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005635
SSX1 MISSION shRNA shRNA Plasmid DNA
synovial sarcoma, X breakpoint 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005635.2-403s1c1
Sequence:CCGGCCACAGAATCATCCCGAAGATCTCGAGATCTTCGGGATGATTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005635.2-123s1c1
Sequence:CCGGCCAGGGATGATGCTAAAGCATCTCGAGATGCTTTAGCATCATCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005635.2-292s1c1
Sequence:CCGGCCCACCTTTCATGTGTAATAACTCGAGTTATTACACATGAAAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005635.2-359s1c1
Sequence:CCGGCGCAGGATTCAGGTTGAACATCTCGAGATGTTCAACCTGAATCCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005635.2-176s1c1
Sequence:CCGGGCCACATACTTCTCTAAGAAACTCGAGTTTCTTAGAGAAGTATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005635.2-280s21c1
Sequence:CCGGCAAAGTCACCCTCCCACCTTTCTCGAGAAAGGTGGGAGGGTGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005635.2-906s21c1
Sequence:CCGGACTGAATGCATATTTCGGTTTCTCGAGAAACCGAAATATGCATTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005635.2-882s21c1
Sequence:CCGGCCTTATAATTGATGAGCAAGACTCGAGTCTTGCTCATCAATTATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005635.2-783s21c1
Sequence:CCGGACGGTGAAACTTGAGCGTCATCTCGAGATGACGCTCAAGTTTCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005635
SSX1 MISSION shRNA Lentiviral Transduction Particles
synovial sarcoma, X breakpoint 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005635.2-403s1c1
Sequence:CCGGCCACAGAATCATCCCGAAGATCTCGAGATCTTCGGGATGATTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005635.2-123s1c1
Sequence:CCGGCCAGGGATGATGCTAAAGCATCTCGAGATGCTTTAGCATCATCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005635.2-292s1c1
Sequence:CCGGCCCACCTTTCATGTGTAATAACTCGAGTTATTACACATGAAAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005635.2-359s1c1
Sequence:CCGGCGCAGGATTCAGGTTGAACATCTCGAGATGTTCAACCTGAATCCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005635.2-176s1c1
Sequence:CCGGGCCACATACTTCTCTAAGAAACTCGAGTTTCTTAGAGAAGTATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005635.2-280s21c1
Sequence:CCGGCAAAGTCACCCTCCCACCTTTCTCGAGAAAGGTGGGAGGGTGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005635.2-906s21c1
Sequence:CCGGACTGAATGCATATTTCGGTTTCTCGAGAAACCGAAATATGCATTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005635.2-882s21c1
Sequence:CCGGCCTTATAATTGATGAGCAAGACTCGAGTCTTGCTCATCAATTATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005635.2-783s21c1
Sequence:CCGGACGGTGAAACTTGAGCGTCATCTCGAGATGACGCTCAAGTTTCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks