EMAIL THIS PAGE TO A FRIEND

SSX2

synovial sarcoma, X breakpoint 2

Synonyms: CT5.2 CT5.2A HD21 HOM-MEL-40 SSX
Species: Human SSX2(6757)
UniProtKB ID: Q16385, Q16404, Q5JS26, Q96IP7, Q9BU88
Gene ID:
Human(6757) Summary: The product of this gene belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. They are also capable of eliciting spontaneous humoral and cellular immune responses in cancer patients, and are potentially useful targets in cancer vaccine-based immunotherapy. This gene, and also the SSX1 and SSX4 family members, have been involved in t(X;18)(p11.2;q11.2) translocations that are characteristically found in all synovial sarcomas. This translocation results in the fusion of the synovial sarcoma translocation gene on chromosome 18 to one of the SSX genes on chromosome X. The encoded hybrid proteins are likely responsible for transforming activity. Alternative splicing of this gene results in multiple transcript variants. This gene also has an identical duplicate, GeneID: 727837, located about 45 kb downstream in the opposite orientation on chromosome X. [provided by RefSeq, Jul 2013]
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003147 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003147 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003147 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU219311 MISSION® esiRNA esiRNA targeting human SSX2 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003147 Rosetta Predictions human pricing
NM_175698 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083362 predicted 980
2 SASI_Hs01_00083363 predicted 993
3 SASI_Hs01_00083364 predicted 981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195733 predicted 835
2 SASI_Hs01_00195734 predicted 843
3 SASI_Hs01_00195735 predicted 839
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003147
SSX2 MISSION shRNA Bacterial Glycerol Stock
synovial sarcoma, X breakpoint 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003147.4-631s21c1
Sequence:CCGGAGTCAGAACACACACAACATTCTCGAGAATGTTGTGTGTGTTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003147.4-647s21c1
Sequence:CCGGACATTGGTCGATTCAGTTTGTCTCGAGACAAACTGAATCGACCAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003147.4-562s21c1
Sequence:CCGGCACGAGAGATCTGGAAATAGGCTCGAGCCTATTTCCAGATCTCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003147.4-639s1c1
Sequence:CCGGCACACACAACATTGGTCGATTCTCGAGAATCGACCAATGTTGTGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003147.4-178s1c1
Sequence:CCGGGCCTTCGATGATATTGCCAAACTCGAGTTTGGCAATATCATCGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003147.4-708s1c1
Sequence:CCGGTACACACAACAGGGACCCAAACTCGAGTTTGGGTCCCTGTTGTGTGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021689    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003147.4-801s1c1
Sequence:CCGGCCTGAGGAAGATGACGAGTAACTCGAGTTACTCGTCATCTTCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003147.4-655s1c1
Sequence:CCGGCGATTCAGTTTGTCAACTTCTCTCGAGAGAAGTTGACAAACTGAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003147
SSX2 MISSION shRNA shRNA Plasmid DNA
synovial sarcoma, X breakpoint 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003147.4-631s21c1
Sequence:CCGGAGTCAGAACACACACAACATTCTCGAGAATGTTGTGTGTGTTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003147.4-647s21c1
Sequence:CCGGACATTGGTCGATTCAGTTTGTCTCGAGACAAACTGAATCGACCAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003147.4-562s21c1
Sequence:CCGGCACGAGAGATCTGGAAATAGGCTCGAGCCTATTTCCAGATCTCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003147.4-639s1c1
Sequence:CCGGCACACACAACATTGGTCGATTCTCGAGAATCGACCAATGTTGTGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003147.4-178s1c1
Sequence:CCGGGCCTTCGATGATATTGCCAAACTCGAGTTTGGCAATATCATCGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003147.4-708s1c1
Sequence:CCGGTACACACAACAGGGACCCAAACTCGAGTTTGGGTCCCTGTTGTGTGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021689    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003147.4-801s1c1
Sequence:CCGGCCTGAGGAAGATGACGAGTAACTCGAGTTACTCGTCATCTTCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003147.4-655s1c1
Sequence:CCGGCGATTCAGTTTGTCAACTTCTCTCGAGAGAAGTTGACAAACTGAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003147
SSX2 MISSION shRNA Lentiviral Transduction Particles
synovial sarcoma, X breakpoint 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003147.4-631s21c1
Sequence:CCGGAGTCAGAACACACACAACATTCTCGAGAATGTTGTGTGTGTTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003147.4-647s21c1
Sequence:CCGGACATTGGTCGATTCAGTTTGTCTCGAGACAAACTGAATCGACCAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003147.4-562s21c1
Sequence:CCGGCACGAGAGATCTGGAAATAGGCTCGAGCCTATTTCCAGATCTCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003147.4-639s1c1
Sequence:CCGGCACACACAACATTGGTCGATTCTCGAGAATCGACCAATGTTGTGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003147.4-178s1c1
Sequence:CCGGGCCTTCGATGATATTGCCAAACTCGAGTTTGGCAATATCATCGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003147.4-708s1c1
Sequence:CCGGTACACACAACAGGGACCCAAACTCGAGTTTGGGTCCCTGTTGTGTGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021689    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003147.4-801s1c1
Sequence:CCGGCCTGAGGAAGATGACGAGTAACTCGAGTTACTCGTCATCTTCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003147.4-655s1c1
Sequence:CCGGCGATTCAGTTTGTCAACTTCTCTCGAGAGAAGTTGACAAACTGAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks