EMAIL THIS PAGE TO A FRIEND

SSX2IP

synovial sarcoma, X breakpoint 2 interacting protein

Synonyms: ADIP
Gene ID:
Human(117178) Summary: This gene encodes a protein that binds the cancer-testis antigen Synovial Sarcoma X breakpoint 2 protein. The encoded protein may regulate the activity of Synovial Sarcoma X breakpoint 2 protein in malignant cells. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 3. [provided by RefSeq, Oct 2009]
Mouse(99167) synovial sarcoma, X breakpoint 2 interacting protein
Rat(308023) synovial sarcoma, X breakpoint 2 interacting protein
Zebrafish(393808) synovial sarcoma, X breakpoint 2 interacting protein
chicken(424532) synovial sarcoma, X breakpoint 2 interacting protein
domestic cat(101097747) synovial sarcoma, X breakpoint 2 interacting protein
Horse(100064652) synovial sarcoma, X breakpoint 2 interacting protein
dog(479970) synovial sarcoma, X breakpoint 2 interacting protein
domestic guinea pig(100731425) synovial sarcoma, X breakpoint 2 interacting protein
naked mole-rat(101716792) synovial sarcoma, X breakpoint 2 interacting protein
cow(534692) synovial sarcoma, X breakpoint 2 interacting protein
sheep(101110888) synovial sarcoma, X breakpoint 2 interacting protein
Gene Class: Cytoskeleton
141 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014021 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014021 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014021 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138744 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138744 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138744 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014021 Rosetta Predictions human pricing
NM_175597 Rosetta Predictions rat pricing
NM_138744 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014021 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344999 predicted 1711
2 SASI_Hs01_00115620 predicted 1771
3 SASI_Hs01_00115622 predicted 1632
4 SASI_Hs02_00345000 predicted 1419
5 SASI_Hs01_00115624 predicted 1669
6 SASI_Hs01_00115625 predicted 694
7 SASI_Hs01_00115626 predicted 829
8 SASI_Hs01_00115627 predicted 1505
9 SASI_Hs01_00115628 predicted 384
10 SASI_Hs02_00345001 predicted 565
11 SASI_Hs01_00115619 predicted 1166
12 SASI_Hs01_00115621 predicted 2177
13 SASI_Hs01_00115623 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077795 predicted 533
2 SASI_Rn01_00077796 predicted 647
3 SASI_Rn01_00077798 predicted 1536
4 SASI_Rn01_00077799 predicted 1283
5 SASI_Rn02_00269497 predicted 2278
6 SASI_Rn02_00269498 predicted 371
7 SASI_Rn01_00077801 predicted 1723
8 SASI_Rn01_00077802 predicted 961
9 SASI_Rn01_00077803 predicted 556
10 SASI_Rn01_00077804 predicted 549
11 SASI_Rn01_00077797 predicted 1996
12 SASI_Rn01_00077800 predicted 2014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138744 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185985 predicted 292
2 SASI_Mm02_00339793 predicted 408
3 SASI_Mm01_00185986 predicted 1155
4 SASI_Mm01_00185987 predicted 1334
5 SASI_Mm01_00185988 predicted 1252
6 SASI_Mm01_00185989 predicted 1903
7 SASI_Mm01_00185990 predicted 1414
8 SASI_Mm01_00185991 predicted 1868
9 SASI_Mm01_00185992 predicted 1878
10 SASI_Mm01_00185993 predicted 2069
11 SASI_Mm01_00185994 predicted 2144
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014021
SSX2IP MISSION shRNA Bacterial Glycerol Stock
synovial sarcoma, X breakpoint 2 interacting protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014021.2-1977s1c1
Sequence:CCGGCCAAATCAGGTTGGAGGAGAACTCGAGTTCTCCTCCAACCTGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014021.2-894s1c1
Sequence:CCGGGAACGTCTACATCAACTTGTTCTCGAGAACAAGTTGATGTAGACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014021.2-4585s1c1
Sequence:CCGGGCAGTCTATGATGAGAAACAACTCGAGTTGTTTCTCATCATAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014021.2-1915s1c1
Sequence:CCGGGTTCCTGCATATCTGAACATACTCGAGTATGTTCAGATATGCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014021.2-717s1c1
Sequence:CCGGGAAATGATTGGGCTTCAGGAACTCGAGTTCCTGAAGCCCAATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014021.2-1914s1c1
Sequence:CCGGCGTTCCTGCATATCTGAACATCTCGAGATGTTCAGATATGCAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014021.2-4147s1c1
Sequence:CCGGCCAGACTCATTGCACCTTCAACTCGAGTTGAAGGTGCAATGAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014021.2-1234s1c1
Sequence:CCGGGAGAGAGTATGTGGGACCTTTCTCGAGAAAGGTCCCACATACTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014021.3-510s21c1
Sequence:CCGGATTGAACAGAGTATCTCATATCTCGAGATATGAGATACTCTGTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014021.3-1240s21c1
Sequence:CCGGATAGTACAGGAACTGTTATTTCTCGAGAAATAACAGTTCCTGTACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014021.3-1567s21c1
Sequence:CCGGATGATACCACTTCACTATTACCTCGAGGTAATAGTGAAGTGGTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014021
SSX2IP MISSION shRNA shRNA Plasmid DNA
synovial sarcoma, X breakpoint 2 interacting protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014021.2-1977s1c1
Sequence:CCGGCCAAATCAGGTTGGAGGAGAACTCGAGTTCTCCTCCAACCTGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014021.2-894s1c1
Sequence:CCGGGAACGTCTACATCAACTTGTTCTCGAGAACAAGTTGATGTAGACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014021.2-4585s1c1
Sequence:CCGGGCAGTCTATGATGAGAAACAACTCGAGTTGTTTCTCATCATAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014021.2-1915s1c1
Sequence:CCGGGTTCCTGCATATCTGAACATACTCGAGTATGTTCAGATATGCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014021.2-717s1c1
Sequence:CCGGGAAATGATTGGGCTTCAGGAACTCGAGTTCCTGAAGCCCAATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014021.2-1914s1c1
Sequence:CCGGCGTTCCTGCATATCTGAACATCTCGAGATGTTCAGATATGCAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014021.2-4147s1c1
Sequence:CCGGCCAGACTCATTGCACCTTCAACTCGAGTTGAAGGTGCAATGAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014021.2-1234s1c1
Sequence:CCGGGAGAGAGTATGTGGGACCTTTCTCGAGAAAGGTCCCACATACTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014021.3-510s21c1
Sequence:CCGGATTGAACAGAGTATCTCATATCTCGAGATATGAGATACTCTGTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014021.3-1240s21c1
Sequence:CCGGATAGTACAGGAACTGTTATTTCTCGAGAAATAACAGTTCCTGTACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014021.3-1567s21c1
Sequence:CCGGATGATACCACTTCACTATTACCTCGAGGTAATAGTGAAGTGGTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014021
SSX2IP MISSION shRNA Lentiviral Transduction Particles
synovial sarcoma, X breakpoint 2 interacting protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014021.2-1977s1c1
Sequence:CCGGCCAAATCAGGTTGGAGGAGAACTCGAGTTCTCCTCCAACCTGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014021.2-894s1c1
Sequence:CCGGGAACGTCTACATCAACTTGTTCTCGAGAACAAGTTGATGTAGACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014021.2-4585s1c1
Sequence:CCGGGCAGTCTATGATGAGAAACAACTCGAGTTGTTTCTCATCATAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014021.2-1915s1c1
Sequence:CCGGGTTCCTGCATATCTGAACATACTCGAGTATGTTCAGATATGCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014021.2-717s1c1
Sequence:CCGGGAAATGATTGGGCTTCAGGAACTCGAGTTCCTGAAGCCCAATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014021.2-1914s1c1
Sequence:CCGGCGTTCCTGCATATCTGAACATCTCGAGATGTTCAGATATGCAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014021.2-4147s1c1
Sequence:CCGGCCAGACTCATTGCACCTTCAACTCGAGTTGAAGGTGCAATGAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014021.2-1234s1c1
Sequence:CCGGGAGAGAGTATGTGGGACCTTTCTCGAGAAAGGTCCCACATACTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014021.3-510s21c1
Sequence:CCGGATTGAACAGAGTATCTCATATCTCGAGATATGAGATACTCTGTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014021.3-1240s21c1
Sequence:CCGGATAGTACAGGAACTGTTATTTCTCGAGAAATAACAGTTCCTGTACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014021.3-1567s21c1
Sequence:CCGGATGATACCACTTCACTATTACCTCGAGGTAATAGTGAAGTGGTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138744
VALIDATED
SSX2IP MISSION shRNA Bacterial Glycerol Stock
synovial sarcoma, X breakpoint 2 interacting protein
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138744.1-316s1c1
Sequence:CCGGCAAAGATGTCTCCGTCCAGTTCTCGAGAACTGGACGGAGACATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138744.1-725s1c1
Sequence:CCGGGCAGTGCAAGAACAGGAGTTTCTCGAGAAACTCCTGTTCTTGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138744.1-1688s1c1
Sequence:CCGGGACGAACTTTGACCACCAGAACTCGAGTTCTGGTGGTCAAAGTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138744.1-2217s1c1
Sequence:CCGGGCTGAAATGCTAAGCTACTTACTCGAGTAAGTAGCTTAGCATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138744.1-415s1c1
Sequence:CCGGGAGAGAACATTGAACAAAGTACTCGAGTACTTTGTTCAATGTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138744.1-1503s1c1
Sequence:CCGGCGAGACTGTTACTTGCTGGAACTCGAGTTCCAGCAAGTAACAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217305    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138744.2-2927s1c1
Sequence:CCGGGATAGCTGGATGCTCATATTTCTCGAGAAATATGAGCATCCAGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138744.2-415s21c1
Sequence:CCGGGAGAGAACATTGAACAAAGTACTCGAGTACTTTGTTCAATGTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138744.2-1688s21c1
Sequence:CCGGGACGAACTTTGACCACCAGAACTCGAGTTCTGGTGGTCAAAGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138744.2-1503s21c1
Sequence:CCGGCGAGACTGTTACTTGCTGGAACTCGAGTTCCAGCAAGTAACAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138744.2-2217s21c1
Sequence:CCGGGCTGAAATGCTAAGCTACTTACTCGAGTAAGTAGCTTAGCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138744
VALIDATED
SSX2IP MISSION shRNA shRNA Plasmid DNA
synovial sarcoma, X breakpoint 2 interacting protein
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138744.1-316s1c1
Sequence:CCGGCAAAGATGTCTCCGTCCAGTTCTCGAGAACTGGACGGAGACATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138744.1-725s1c1
Sequence:CCGGGCAGTGCAAGAACAGGAGTTTCTCGAGAAACTCCTGTTCTTGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138744.1-1688s1c1
Sequence:CCGGGACGAACTTTGACCACCAGAACTCGAGTTCTGGTGGTCAAAGTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138744.1-2217s1c1
Sequence:CCGGGCTGAAATGCTAAGCTACTTACTCGAGTAAGTAGCTTAGCATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138744.1-415s1c1
Sequence:CCGGGAGAGAACATTGAACAAAGTACTCGAGTACTTTGTTCAATGTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138744.1-1503s1c1
Sequence:CCGGCGAGACTGTTACTTGCTGGAACTCGAGTTCCAGCAAGTAACAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217305    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138744.2-2927s1c1
Sequence:CCGGGATAGCTGGATGCTCATATTTCTCGAGAAATATGAGCATCCAGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138744.2-415s21c1
Sequence:CCGGGAGAGAACATTGAACAAAGTACTCGAGTACTTTGTTCAATGTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138744.2-1688s21c1
Sequence:CCGGGACGAACTTTGACCACCAGAACTCGAGTTCTGGTGGTCAAAGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138744.2-1503s21c1
Sequence:CCGGCGAGACTGTTACTTGCTGGAACTCGAGTTCCAGCAAGTAACAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138744.2-2217s21c1
Sequence:CCGGGCTGAAATGCTAAGCTACTTACTCGAGTAAGTAGCTTAGCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138744
VALIDATED
SSX2IP MISSION shRNA Lentiviral Transduction Particles
synovial sarcoma, X breakpoint 2 interacting protein
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138744.1-316s1c1
Sequence:CCGGCAAAGATGTCTCCGTCCAGTTCTCGAGAACTGGACGGAGACATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138744.1-725s1c1
Sequence:CCGGGCAGTGCAAGAACAGGAGTTTCTCGAGAAACTCCTGTTCTTGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138744.1-1688s1c1
Sequence:CCGGGACGAACTTTGACCACCAGAACTCGAGTTCTGGTGGTCAAAGTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138744.1-2217s1c1
Sequence:CCGGGCTGAAATGCTAAGCTACTTACTCGAGTAAGTAGCTTAGCATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138744.1-415s1c1
Sequence:CCGGGAGAGAACATTGAACAAAGTACTCGAGTACTTTGTTCAATGTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138744.1-1503s1c1
Sequence:CCGGCGAGACTGTTACTTGCTGGAACTCGAGTTCCAGCAAGTAACAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217305    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138744.2-2927s1c1
Sequence:CCGGGATAGCTGGATGCTCATATTTCTCGAGAAATATGAGCATCCAGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138744.2-415s21c1
Sequence:CCGGGAGAGAACATTGAACAAAGTACTCGAGTACTTTGTTCAATGTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138744.2-1688s21c1
Sequence:CCGGGACGAACTTTGACCACCAGAACTCGAGTTCTGGTGGTCAAAGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138744.2-1503s21c1
Sequence:CCGGCGAGACTGTTACTTGCTGGAACTCGAGTTCCAGCAAGTAACAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138744.2-2217s21c1
Sequence:CCGGGCTGAAATGCTAAGCTACTTACTCGAGTAAGTAGCTTAGCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks