EMAIL THIS PAGE TO A FRIEND

SSX3

synovial sarcoma, X breakpoint 3

Synonyms: CT5.3
Species: Human SSX3(10214)
UniProtKB ID: Q99909, O60223, Q5JQZ3, Q9BRW7
Gene ID:
Human(10214) Summary: The product of this gene belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. They are also capable of eliciting spontaneous humoral and cellular immune responses in cancer patients, and are potentially useful targets in cancer vaccine-based immunotherapy. While some of the related SSX genes are involved in t(X;18)(p11.2;q11.2) translocations that are characteristically found in all synovial sarcomas, this gene does not appear to be involved in such translocations. [provided by RefSeq, Jul 2013]
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021014 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021014 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021014 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127771 MISSION® esiRNA esiRNA human SSX3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021014 Rosetta Predictions human pricing
NM_175711 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014644 predicted 275
2 SASI_Hs01_00014646 predicted 281
3 SASI_Hs01_00014647 predicted 540
4 SASI_Hs01_00014648 predicted 530
5 SASI_Hs01_00014650 predicted 98
6 SASI_Hs01_00014649 predicted 853
7 SASI_Hs01_00014643 predicted 289
8 SASI_Hs01_00014645 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242776 predicted 279
2 SASI_Hs01_00242778 predicted 278
3 SASI_Hs01_00242779 predicted 97
4 SASI_Hs01_00242775 predicted 286
5 SASI_Hs01_00242777 predicted 284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021014
SSX3 MISSION shRNA Bacterial Glycerol Stock
synovial sarcoma, X breakpoint 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021014.2-966s21c1
Sequence:CCGGGTCAGTTACCTCTGCATGGAACTCGAGTTCCATGCAGAGGTAACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021014.2-374s21c1
Sequence:CCGGGTTCAACGTCCTCAGATGACTCTCGAGAGTCATCTGAGGACGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021014.2-825s21c1
Sequence:CCGGGAGTACGATATTAGCGTTTCCCTCGAGGGAAACGCTAATATCGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021014.2-295s1c1
Sequence:CCGGCCCATCTTTCATGCGTAATAACTCGAGTTATTACGCATGAAAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021014.2-165s1c1
Sequence:CCGGCCTTCGATGATATTGCCAAATCTCGAGATTTGGCAATATCATCGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021014.2-179s1c1
Sequence:CCGGGCCAAATACTTCTCTAAGGAACTCGAGTTCCTTAGAGAAGTATTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021014.2-535s1c1
Sequence:CCGGCTCTGAGAAGATTAACATGATCTCGAGATCATGTTAATCTTCTCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021014
SSX3 MISSION shRNA shRNA Plasmid DNA
synovial sarcoma, X breakpoint 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021014.2-966s21c1
Sequence:CCGGGTCAGTTACCTCTGCATGGAACTCGAGTTCCATGCAGAGGTAACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021014.2-374s21c1
Sequence:CCGGGTTCAACGTCCTCAGATGACTCTCGAGAGTCATCTGAGGACGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021014.2-825s21c1
Sequence:CCGGGAGTACGATATTAGCGTTTCCCTCGAGGGAAACGCTAATATCGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021014.2-295s1c1
Sequence:CCGGCCCATCTTTCATGCGTAATAACTCGAGTTATTACGCATGAAAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021014.2-165s1c1
Sequence:CCGGCCTTCGATGATATTGCCAAATCTCGAGATTTGGCAATATCATCGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021014.2-179s1c1
Sequence:CCGGGCCAAATACTTCTCTAAGGAACTCGAGTTCCTTAGAGAAGTATTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021014.2-535s1c1
Sequence:CCGGCTCTGAGAAGATTAACATGATCTCGAGATCATGTTAATCTTCTCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021014
SSX3 MISSION shRNA Lentiviral Transduction Particles
synovial sarcoma, X breakpoint 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021014.2-966s21c1
Sequence:CCGGGTCAGTTACCTCTGCATGGAACTCGAGTTCCATGCAGAGGTAACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021014.2-374s21c1
Sequence:CCGGGTTCAACGTCCTCAGATGACTCTCGAGAGTCATCTGAGGACGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021014.2-825s21c1
Sequence:CCGGGAGTACGATATTAGCGTTTCCCTCGAGGGAAACGCTAATATCGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021014.2-295s1c1
Sequence:CCGGCCCATCTTTCATGCGTAATAACTCGAGTTATTACGCATGAAAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021014.2-165s1c1
Sequence:CCGGCCTTCGATGATATTGCCAAATCTCGAGATTTGGCAATATCATCGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021014.2-179s1c1
Sequence:CCGGGCCAAATACTTCTCTAAGGAACTCGAGTTCCTTAGAGAAGTATTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021014.2-535s1c1
Sequence:CCGGCTCTGAGAAGATTAACATGATCTCGAGATCATGTTAATCTTCTCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks