EMAIL THIS PAGE TO A FRIEND

SSX4

synovial sarcoma, X breakpoint 4

Synonyms: CT5.4
Species: Human SSX4(6759)
UniProtKB ID: O60224, B2RPE3, Q5JQZ0, Q9UJU9
Gene ID:
Human(6759) Summary: The product of this gene belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. They are also capable of eliciting spontaneously humoral and cellular immune responses in cancer patients, and are potentially useful targets in cancer vaccine-based immunotherapy. SSX1, SSX2 and SSX4 genes have been involved in the t(X;18) translocation characteristically found in all synovial sarcomas. This translocation results in the fusion of the synovial sarcoma translocation gene on chromosome 18 to one of the SSX genes on chromosome X. Chromosome Xp11 contains a segmental duplication resulting in two identical copies of synovial sarcoma, X breakpoint 4, SSX4 and SSX4B, in tail-to-tail orientation. This gene, SSX4, represents the more telomeric copy. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005636 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005636 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005636 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005636 Rosetta Predictions human pricing
NM_175729 Rosetta Predictions human pricing
XM_001725018 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119945 predicted 92
2 SASI_Hs01_00119946 predicted 490
3 SASI_Hs01_00119947 predicted 87
4 SASI_Hs01_00119948 predicted 483
5 SASI_Hs01_00119949 predicted 494
6 SASI_Hs01_00119950 predicted 196
7 SASI_Hs01_00119951 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131795 predicted 95
2 SASI_Hs01_00131796 predicted 90
3 SASI_Hs01_00131797 predicted 191
4 SASI_Hs01_00131798 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00465067 predicted 385
2 SASI_Hs02_00465068 predicted 595
3 SASI_Hs02_00465069 predicted 368
4 SASI_Hs02_00465070 predicted 202
5 SASI_Hs02_00465071 predicted 591
6 SASI_Hs02_00465072 predicted 189
7 SASI_Hs02_00465073 predicted 597
8 SASI_Hs02_00465074 predicted 296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005636
SSX4 MISSION shRNA Bacterial Glycerol Stock
synovial sarcoma, X breakpoint 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005636.3-211s1c1
Sequence:CCGGGAAGCTAAACTATGAGGTCATCTCGAGATGACCTCATAGTTTAGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005636.3-90s1c1
Sequence:CCGGCCAGGGATGATGCTCAAATATCTCGAGATATTTGAGCATCATCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005636.3-370s1c1
Sequence:CCGGCCAGAGAATCTTCCCGAAGATCTCGAGATCTTCGGGAAGATTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005636.3-259s1c1
Sequence:CCGGCCCACCTTTCATGCGTAGTAACTCGAGTTACTACGCATGAAAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005636.3-143s1c1
Sequence:CCGGGCCAAATACTTCTCTAAGAAACTCGAGTTTCTTAGAGAAGTATTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005636
SSX4 MISSION shRNA shRNA Plasmid DNA
synovial sarcoma, X breakpoint 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005636.3-211s1c1
Sequence:CCGGGAAGCTAAACTATGAGGTCATCTCGAGATGACCTCATAGTTTAGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005636.3-90s1c1
Sequence:CCGGCCAGGGATGATGCTCAAATATCTCGAGATATTTGAGCATCATCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005636.3-370s1c1
Sequence:CCGGCCAGAGAATCTTCCCGAAGATCTCGAGATCTTCGGGAAGATTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005636.3-259s1c1
Sequence:CCGGCCCACCTTTCATGCGTAGTAACTCGAGTTACTACGCATGAAAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005636.3-143s1c1
Sequence:CCGGGCCAAATACTTCTCTAAGAAACTCGAGTTTCTTAGAGAAGTATTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005636
SSX4 MISSION shRNA Lentiviral Transduction Particles
synovial sarcoma, X breakpoint 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005636.3-211s1c1
Sequence:CCGGGAAGCTAAACTATGAGGTCATCTCGAGATGACCTCATAGTTTAGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005636.3-90s1c1
Sequence:CCGGCCAGGGATGATGCTCAAATATCTCGAGATATTTGAGCATCATCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005636.3-370s1c1
Sequence:CCGGCCAGAGAATCTTCCCGAAGATCTCGAGATCTTCGGGAAGATTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005636.3-259s1c1
Sequence:CCGGCCCACCTTTCATGCGTAGTAACTCGAGTTACTACGCATGAAAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005636.3-143s1c1
Sequence:CCGGGCCAAATACTTCTCTAAGAAACTCGAGTTTCTTAGAGAAGTATTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks