EMAIL THIS PAGE TO A FRIEND

SSX4B

synovial sarcoma, X breakpoint 4B

Synonyms: CT5.4
Species: Human SSX4B(548313)
Gene ID:
Human(548313) Summary: The product of this gene belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. They are also capable of eliciting spontaneously humoral and cellular immune responses in cancer patients, and are potentially useful targets in cancer vaccine-based immunotherapy. SSX1, SSX2 and SSX4 genes have been involved in the t(X;18) translocation characteristically found in all synovial sarcomas. This translocation results in the fusion of the synovial sarcoma translocation gene on chromosome 18 to one of the SSX genes on chromosome X. Chromosome Xp11 contains a segmental duplication resulting in two identical copies of synovial sarcoma, X breakpoint 4, SSX4 and SSX4B, in tail-to-tail orientation. This gene, SSX4B, represents the more centromeric copy. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001034832 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001034832 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001034832 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034832 Rosetta Predictions human pricing
NM_001040612 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054185 predicted 99
2 SASI_Hs01_00054186 predicted 483
3 SASI_Hs01_00054187 predicted 93
4 SASI_Hs01_00054188 predicted 490
5 SASI_Hs01_00054189 predicted 493
6 SASI_Hs01_00054190 predicted 195
7 SASI_Hs01_00054191 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154680 predicted 100
2 SASI_Hs01_00154681 predicted 86
3 SASI_Hs01_00154682 predicted 193
4 SASI_Hs01_00154683 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034832
SSX4B MISSION shRNA Bacterial Glycerol Stock
synovial sarcoma, X breakpoint 4B
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000180998    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001034832.1-996s1c1
Sequence:CCGGGCTTGTGTATCCATGCACCTACTCGAGTAGGTGCATGGATACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034832.1-194s1c1
Sequence:CCGGCCCAGGGATGATGCTCAAATACTCGAGTATTTGAGCATCATCCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034832.1-596s1c1
Sequence:CCGGCCAAGTACCTTGGAGAAGATTCTCGAGAATCTTCTCCAAGGTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179583    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001034832.1-682s1c1
Sequence:CCGGGCTGGTGGTTTATGAAGAGATCTCGAGATCTCTTCATAAACCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034832
SSX4B MISSION shRNA shRNA Plasmid DNA
synovial sarcoma, X breakpoint 4B
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000180998    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001034832.1-996s1c1
Sequence:CCGGGCTTGTGTATCCATGCACCTACTCGAGTAGGTGCATGGATACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034832.1-194s1c1
Sequence:CCGGCCCAGGGATGATGCTCAAATACTCGAGTATTTGAGCATCATCCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034832.1-596s1c1
Sequence:CCGGCCAAGTACCTTGGAGAAGATTCTCGAGAATCTTCTCCAAGGTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179583    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001034832.1-682s1c1
Sequence:CCGGGCTGGTGGTTTATGAAGAGATCTCGAGATCTCTTCATAAACCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034832
SSX4B MISSION shRNA Lentiviral Transduction Particles
synovial sarcoma, X breakpoint 4B
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000180998    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001034832.1-996s1c1
Sequence:CCGGGCTTGTGTATCCATGCACCTACTCGAGTAGGTGCATGGATACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034832.1-194s1c1
Sequence:CCGGCCCAGGGATGATGCTCAAATACTCGAGTATTTGAGCATCATCCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034832.1-596s1c1
Sequence:CCGGCCAAGTACCTTGGAGAAGATTCTCGAGAATCTTCTCCAAGGTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179583    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001034832.1-682s1c1
Sequence:CCGGGCTGGTGGTTTATGAAGAGATCTCGAGATCTCTTCATAAACCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks