EMAIL THIS PAGE TO A FRIEND

SSX5

synovial sarcoma, X breakpoint 5

UniProtKB ID: O60225, Q5JQ59, Q5JQ60, Q96AW3
Gene ID:
Human(6758) Summary: The product of this gene belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. They are also capable of eliciting spontaneous humoral and cellular immune responses in cancer patients, and are potentially useful targets in cancer vaccine-based immunotherapy. While some of the related SSX genes are involved in t(X;18)(p11.2;q11.2) translocations that are characteristically found in all synovial sarcomas, this gene does not appear to be involved in such translocations. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2013]
dog(612524) synovial sarcoma, X breakpoint 5
cow(767992) synovial sarcoma, X breakpoint 5
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175723 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175723 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175723 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152981 MISSION® esiRNA esiRNA human SSX5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021015 Rosetta Predictions human pricing
NM_175723 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051947 predicted 145
2 SASI_Hs02_00354488 predicted 984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369053 predicted 861
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175723
SSX5 MISSION shRNA Bacterial Glycerol Stock
synovial sarcoma, X breakpoint 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175723.1-775s1c1
Sequence:CCGGGTGTGCCAAGAGTTCGATGTTCTCGAGAACATCGAACTCTTGGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175723.1-399s1c1
Sequence:CCGGCCAGCAGAGGAAGGAAATGATCTCGAGATCATTTCCTTCCTCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175723.1-321s1c1
Sequence:CCGGCGTGGGAATCAGGTTGAACATCTCGAGATGTTCAACCTGATTCCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175723.1-84s1c1
Sequence:CCGGCCTAGGGTTGGTTCTCAAATACTCGAGTATTTGAGAACCAACCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175723.1-254s1c1
Sequence:CCGGCCCACCTTTCATGCGTAATAACTCGAGTTATTACGCATGAAAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175723.1-138s1c1
Sequence:CCGGGCCAAATACTTCTCTGAGAAACTCGAGTTTCTCAGAGAAGTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175723.1-206s1c1
Sequence:CCGGGAAGAGAAAGTATGAGGCCATCTCGAGATGGCCTCATACTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175723.1-561s1c1
Sequence:CCGGGAGAGAAAGCAACTGGTGATTCTCGAGAATCACCAGTTGCTTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175723.1-732s1c1
Sequence:CCGGGCAAGTGTTCACAACAGTGAACTCGAGTTCACTGTTGTGAACACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175723
SSX5 MISSION shRNA shRNA Plasmid DNA
synovial sarcoma, X breakpoint 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175723.1-775s1c1
Sequence:CCGGGTGTGCCAAGAGTTCGATGTTCTCGAGAACATCGAACTCTTGGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175723.1-399s1c1
Sequence:CCGGCCAGCAGAGGAAGGAAATGATCTCGAGATCATTTCCTTCCTCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175723.1-321s1c1
Sequence:CCGGCGTGGGAATCAGGTTGAACATCTCGAGATGTTCAACCTGATTCCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175723.1-84s1c1
Sequence:CCGGCCTAGGGTTGGTTCTCAAATACTCGAGTATTTGAGAACCAACCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175723.1-254s1c1
Sequence:CCGGCCCACCTTTCATGCGTAATAACTCGAGTTATTACGCATGAAAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175723.1-138s1c1
Sequence:CCGGGCCAAATACTTCTCTGAGAAACTCGAGTTTCTCAGAGAAGTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175723.1-206s1c1
Sequence:CCGGGAAGAGAAAGTATGAGGCCATCTCGAGATGGCCTCATACTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175723.1-561s1c1
Sequence:CCGGGAGAGAAAGCAACTGGTGATTCTCGAGAATCACCAGTTGCTTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175723.1-732s1c1
Sequence:CCGGGCAAGTGTTCACAACAGTGAACTCGAGTTCACTGTTGTGAACACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175723
SSX5 MISSION shRNA Lentiviral Transduction Particles
synovial sarcoma, X breakpoint 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157537    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175723.1-775s1c1
Sequence:CCGGGTGTGCCAAGAGTTCGATGTTCTCGAGAACATCGAACTCTTGGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175723.1-399s1c1
Sequence:CCGGCCAGCAGAGGAAGGAAATGATCTCGAGATCATTTCCTTCCTCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175723.1-321s1c1
Sequence:CCGGCGTGGGAATCAGGTTGAACATCTCGAGATGTTCAACCTGATTCCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175723.1-84s1c1
Sequence:CCGGCCTAGGGTTGGTTCTCAAATACTCGAGTATTTGAGAACCAACCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175723.1-254s1c1
Sequence:CCGGCCCACCTTTCATGCGTAATAACTCGAGTTATTACGCATGAAAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175723.1-138s1c1
Sequence:CCGGGCCAAATACTTCTCTGAGAAACTCGAGTTTCTCAGAGAAGTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175723.1-206s1c1
Sequence:CCGGGAAGAGAAAGTATGAGGCCATCTCGAGATGGCCTCATACTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175723.1-561s1c1
Sequence:CCGGGAGAGAAAGCAACTGGTGATTCTCGAGAATCACCAGTTGCTTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175723.1-732s1c1
Sequence:CCGGGCAAGTGTTCACAACAGTGAACTCGAGTTCACTGTTGTGAACACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks