EMAIL THIS PAGE TO A FRIEND

SSX7

synovial sarcoma, X breakpoint 7

Species: Human SSX7(280658)
UniProtKB ID: Q7RTT5
Gene ID:
Human(280658) Summary: The product of this gene belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. They are also capable of eliciting spontaneously humoral and cellular immune responses in cancer patients, and are potentially useful targets in cancer vaccine-based immunotherapy. SSX1, SSX2 and SSX4 genes have been involved in the t(X;18) translocation characteristically found in all synovial sarcomas. This gene appears not to be involved in this type of chromosome translocation. [provided by RefSeq, Jul 2008]
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173358 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173358 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173358 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173358 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186376 predicted 414
2 SASI_Hs01_00186375 predicted 565
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173358
SSX7 MISSION shRNA Bacterial Glycerol Stock
synovial sarcoma, X breakpoint 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173358.2-1009s1c1
Sequence:CCGGCCTACCTCAGAAAGCAAGTATCTCGAGATACTTGCTTTCTGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173358.2-357s1c1
Sequence:CCGGCCTCCCACCTTTCATGCATAACTCGAGTTATGCATGAAAGGTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173358.2-592s1c1
Sequence:CCGGCCAAGTACCTCTGAGAAGATTCTCGAGAATCTTCTCAGAGGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173358.2-358s1c1
Sequence:CCGGCTCCCACCTTTCATGCATAATCTCGAGATTATGCATGAAAGGTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173358.2-505s1c1
Sequence:CCGGCCAGCAGAGGAAGGAAATGATCTCGAGATCATTTCCTTCCTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173358.2-189s21c1
Sequence:CCGGACCTAGGGCTGGTGCTCAAATCTCGAGATTTGAGCACCAGCCCTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173358.2-425s21c1
Sequence:CCGGACCAAGGGAATCAGGTTGAACCTCGAGGTTCAACCTGATTCCCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173358.2-1100s21c1
Sequence:CCGGTGAGTGTTTAATTTCCGATTTCTCGAGAAATCGGAAATTAAACACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173358.2-883s21c1
Sequence:CCGGGTGACAAGAGTTCGATGTTAGCTCGAGCTAACATCGAACTCTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173358
SSX7 MISSION shRNA shRNA Plasmid DNA
synovial sarcoma, X breakpoint 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173358.2-1009s1c1
Sequence:CCGGCCTACCTCAGAAAGCAAGTATCTCGAGATACTTGCTTTCTGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173358.2-357s1c1
Sequence:CCGGCCTCCCACCTTTCATGCATAACTCGAGTTATGCATGAAAGGTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173358.2-592s1c1
Sequence:CCGGCCAAGTACCTCTGAGAAGATTCTCGAGAATCTTCTCAGAGGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173358.2-358s1c1
Sequence:CCGGCTCCCACCTTTCATGCATAATCTCGAGATTATGCATGAAAGGTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173358.2-505s1c1
Sequence:CCGGCCAGCAGAGGAAGGAAATGATCTCGAGATCATTTCCTTCCTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173358.2-189s21c1
Sequence:CCGGACCTAGGGCTGGTGCTCAAATCTCGAGATTTGAGCACCAGCCCTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173358.2-425s21c1
Sequence:CCGGACCAAGGGAATCAGGTTGAACCTCGAGGTTCAACCTGATTCCCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173358.2-1100s21c1
Sequence:CCGGTGAGTGTTTAATTTCCGATTTCTCGAGAAATCGGAAATTAAACACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173358.2-883s21c1
Sequence:CCGGGTGACAAGAGTTCGATGTTAGCTCGAGCTAACATCGAACTCTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173358
SSX7 MISSION shRNA Lentiviral Transduction Particles
synovial sarcoma, X breakpoint 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173358.2-1009s1c1
Sequence:CCGGCCTACCTCAGAAAGCAAGTATCTCGAGATACTTGCTTTCTGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173358.2-357s1c1
Sequence:CCGGCCTCCCACCTTTCATGCATAACTCGAGTTATGCATGAAAGGTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173358.2-592s1c1
Sequence:CCGGCCAAGTACCTCTGAGAAGATTCTCGAGAATCTTCTCAGAGGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173358.2-358s1c1
Sequence:CCGGCTCCCACCTTTCATGCATAATCTCGAGATTATGCATGAAAGGTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173358.2-505s1c1
Sequence:CCGGCCAGCAGAGGAAGGAAATGATCTCGAGATCATTTCCTTCCTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173358.2-189s21c1
Sequence:CCGGACCTAGGGCTGGTGCTCAAATCTCGAGATTTGAGCACCAGCCCTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173358.2-425s21c1
Sequence:CCGGACCAAGGGAATCAGGTTGAACCTCGAGGTTCAACCTGATTCCCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173358.2-1100s21c1
Sequence:CCGGTGAGTGTTTAATTTCCGATTTCTCGAGAAATCGGAAATTAAACACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173358.2-883s21c1
Sequence:CCGGGTGACAAGAGTTCGATGTTAGCTCGAGCTAACATCGAACTCTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks